Requirement of ATM-dependent phosphorylation of Brca1 in the DNA damage response to double-strand breaks

Science

Volumn 286, Issue 5442, 1999, Pages 1162-1166

  Cortez, David ^a,b   Wang, Yi ^a,c   Qin, Jun ^a,c   Elledge, Stephen J ^a,b,d  

^a Verna and Marrs McLean Department of Biochemistry and Molecular Biology   (United States)

^b HOWARD HUGHES MEDICAL INSTITUTE   (United States)

^c Department of Cell Biology ^*  (United States)

^d BAYLOR COLLEGE OF MEDICINE   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

ATAXIA TELANGIECTASIA MUTATED PROTEIN KINASE; BRCA1 PROTEIN; PROTEIN KINASE; UNCLASSIFIED DRUG;

ARTICLE; BREAST CANCER; DNA DAMAGE; DNA REPAIR; HUMAN; HUMAN CELL; IONIZING RADIATION; PRIORITY JOURNAL; PROTEIN PHOSPHORYLATION; RADIOSENSITIVITY;

AMINO ACID SEQUENCE; ATAXIA TELANGIECTASIA; BRCA1 PROTEIN; BREAST NEOPLASMS; CELL CYCLE PROTEINS; CELL LINE; DNA DAMAGE; DNA REPAIR; DNA, COMPLEMENTARY; DNA-BINDING PROTEINS; FEMALE; GAMMA RAYS; GENES, BRCA1; GENETIC PREDISPOSITION TO DISEASE; HELA CELLS; HETEROZYGOTE; HUMANS; MOLECULAR SEQUENCE DATA; MUTATION; PHOSPHORYLATION; PROTEIN-SERINE-THREONINE KINASES; RECOMBINANT FUSION PROTEINS; TUMOR SUPPRESSOR PROTEINS;

ATAXIA; ATAXIA TELANGIECTASIA;

EID: 0033527717     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.286.5442.1162     Document Type: Article

References (64)

1. K. W. Kinzler and B. Vogelstein, Nature 386, 761 (1997).
2. K. Savitsky et al., Science 268, 1749 (1995).
3. P. Athma, R. Rappaport, M. Swift, Cancer Genet. Cytogenet. 92, 130 (1995); N. Janin et al., Br. J. Cancer 80, 1042 (1999).
4. P. Athma, R. Rappaport, M. Swift, Cancer Genet. Cytogenet. 92, 130 (1995); N. Janin et al., Br. J. Cancer 80, 1042 (1999).
5. R. Wooster et al., Nature 378, 789 (1995); S. V. Tavtigian et al., Nature Genet. 12, 333 (1996).
6. R. Wooster et al., Nature 378, 789 (1995); S. V. Tavtigian et al., Nature Genet. 12, 333 (1996).
7. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
8. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
9. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
10. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
11. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
12. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
13. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
14. A. Elson et al., Proc. Natl. Acad. Sci. U.S.A. 93, 13084 (1996); Y. Xu et al., Genes Dev. 10, 2411 (1996); F. Connor et al., Nature Genet 17, 423 (1997); A. Suzuki et al., Genes Dev. 11, 1242 (1997); T. Ludwig, D. L. Chapman, V. E. Papaioannou, A. Efstratiadis, Genes Dev. 11, 1226 (1997); K. J. Patel et al., Mol. Cell 1, 347 (1998); G. Rotman and Y. Shiloh, Hum. Mol. Genet. 7, 1555 (1998); S. X. Shen et al., Oncogene 17, 3115 (1998).
15. S. K. Sharan et al., Nature 386, 804 (1997).
16. X. Xu et al., Mol. Cell 3, 389 (1999); M. E. Maynahan, J. W. Chiu, B. H. Koler, M. Jasin, Mol. Cell, in press.
17. X. Xu et al., Mol. Cell 3, 389 (1999); M. E. Maynahan, J. W. Chiu, B. H. Koler, M. Jasin, Mol. Cell, in press.
18. S. J. Elledge, Science 274, 1664 (1996).
19. C. E. Canman et al., Science 281, 1677 (1998).
20. R. Baskaran et al., Nature 387, 516 (1997); S. Banin et al., Science 281, 1674 (1998).
21. R. Baskaran et al., Nature 387, 516 (1997); S. Banin et al., Science 281, 1674 (1998).
22. S. Matsuoka, M. Huang, S. J. Elledge, Science 282, 1893 (1998); P. Chaturvedi et al., Oncogene 18, 4047 (1999); A. Blasina et al., Curr. Biol. 9, 1 (1999).
23. S. Matsuoka, M. Huang, S. J. Elledge, Science 282, 1893 (1998); P. Chaturvedi et al., Oncogene 18, 4047 (1999); A. Blasina et al., Curr. Biol. 9, 1 (1999).
24. S. Matsuoka, M. Huang, S. J. Elledge, Science 282, 1893 (1998); P. Chaturvedi et al., Oncogene 18, 4047 (1999); A. Blasina et al., Curr. Biol. 9, 1 (1999).
25. A. L Brown et al., Proc. Natl. Acad. Sci. U.S.A. 96, 3745 (1999).
26. T. Shafman et al., Nature 387, 520 (1997).
27. D. Blocher, D. Sigut, M. A. Hannan, Int. J. Radiat. Biol. 60, 791 (1991); T. K. Pandita and W. N. Hittelman, Radiat. Res. 131, 214 (1992); N. Foray et al., Int. J. Radiat. Biol. 72, 271 (1997); R. T. Johnson et al., Biochem. Biophys. Res. Commun. 261, 317 (1999).
28. D. Blocher, D. Sigut, M. A. Hannan, Int. J. Radiat. Biol. 60, 791 (1991); T. K. Pandita and W. N. Hittelman, Radiat. Res. 131, 214 (1992); N. Foray et al., Int. J. Radiat. Biol. 72, 271 (1997); R. T. Johnson et al., Biochem. Biophys. Res. Commun. 261, 317 (1999).
29. D. Blocher, D. Sigut, M. A. Hannan, Int. J. Radiat. Biol. 60, 791 (1991); T. K. Pandita and W. N. Hittelman, Radiat. Res. 131, 214 (1992); N. Foray et al., Int. J. Radiat. Biol. 72, 271 (1997); R. T. Johnson et al., Biochem. Biophys. Res. Commun. 261, 317 (1999).
30. D. Blocher, D. Sigut, M. A. Hannan, Int. J. Radiat. Biol. 60, 791 (1991); T. K. Pandita and W. N. Hittelman, Radiat. Res. 131, 214 (1992); N. Foray et al., Int. J. Radiat. Biol. 72, 271 (1997); R. T. Johnson et al., Biochem. Biophys. Res. Commun. 261, 317 (1999).
31. A. K. C Wong, R. Pero, P. A. Ormonde, S, V. Tavtigian, P. L Bartel, J. Biol. Chem. 272, 31941 (1997); R. Mizuta et al., Proc. Natl. Acad. Sci. U.S.A. 94, 6927 (1997); L Y. Marmorstein, T. Ouchi, S. A Aaronson, Proc. Natl Acad. Sci. U.S.A. 95, 13869 (1998).
32. A. K. C Wong, R. Pero, P. A. Ormonde, S, V. Tavtigian, P. L Bartel, J. Biol. Chem. 272, 31941 (1997); R. Mizuta et al., Proc. Natl. Acad. Sci. U.S.A. 94, 6927 (1997); L Y. Marmorstein, T. Ouchi, S. A Aaronson, Proc. Natl Acad. Sci. U.S.A. 95, 13869 (1998).
33. A. K. C Wong, R. Pero, P. A. Ormonde, S, V. Tavtigian, P. L Bartel, J. Biol. Chem. 272, 31941 (1997); R. Mizuta et al., Proc. Natl. Acad. Sci. U.S.A. 94, 6927 (1997); L Y. Marmorstein, T. Ouchi, S. A Aaronson, Proc. Natl Acad. Sci. U.S.A. 95, 13869 (1998).
34. R. Scully et al., Cell 88, 265 (1997); J. J. Chen, D. Silver, S. Cantor, D. M. Livingston, R. Scully, Cancer Res. 59, 1752 (1999).
35. R. Scully et al., Cell 88, 265 (1997); J. J. Chen, D. Silver, S. Cantor, D. M. Livingston, R. Scully, Cancer Res. 59, 1752 (1999).
36. J. Chen et al., Mol. Cell 2, 317 (1998).
37. R. Scully et al., Cell 90, 425 (1997).
38. J. P. Vaughn et al., Cancer Res. 56, 4590 (1996); J. P. Vaughn et al., Cell Growth Differ. 7, 711 (1996); J. V. Rajan, S. T. Marquis, H. P. Gardner, L A. Chodosh, Dev. Biol. 184, 385 (1997); P. E. Blackshear et al., Oncogene 16, 61 (1998).
39. J. P. Vaughn et al., Cancer Res. 56, 4590 (1996); J. P. Vaughn et al., Cell Growth Differ. 7, 711 (1996); J. V. Rajan, S. T. Marquis, H. P. Gardner, L A. Chodosh, Dev. Biol. 184, 385 (1997); P. E. Blackshear et al., Oncogene 16, 61 (1998).
40. J. P. Vaughn et al., Cancer Res. 56, 4590 (1996); J. P. Vaughn et al., Cell Growth Differ. 7, 711 (1996); J. V. Rajan, S. T. Marquis, H. P. Gardner, L A. Chodosh, Dev. Biol. 184, 385 (1997); P. E. Blackshear et al., Oncogene 16, 61 (1998).
41. J. P. Vaughn et al., Cancer Res. 56, 4590 (1996); J. P. Vaughn et al., Cell Growth Differ. 7, 711 (1996); J. V. Rajan, S. T. Marquis, H. P. Gardner, L A. Chodosh, Dev. Biol. 184, 385 (1997); P. E. Blackshear et al., Oncogene 16, 61 (1998).
42. Y. Chen et al., Cancer Res. 56, 3168 (1996); H. Ruffner and I. M. Verma, Proc. Natl. Acad Sci. U.S.A. 94, 7138 (1997).
43. Y. Chen et al., Cancer Res. 56, 3168 (1996); H. Ruffner and I. M. Verma, Proc. Natl. Acad Sci. U.S.A. 94, 7138 (1997).
44. H. Ruffner, W. Jiang, A. G. Craig, T. Hunter, I. M. Verma, Mol. Cell Biol. 19, 4843 (1999).
45. D. Cortez and S. J. Elledge, unpublished data.
46. D. W. Abbott et al., J. Biol .Chem 274, 18808 (1999).
47. J. S. Humphrey et al., Proc. Natl. Acad. Sci. U.S.A 94, 5820 (1997); K. Somasundaram et al., Nature 389, 187 (1997).
48. J. S. Humphrey et al., Proc. Natl. Acad. Sci. U.S.A 94, 5820 (1997); K. Somasundaram et al., Nature 389, 187 (1997).
49. J. D. Siliciano et al., Genes Dev. 11, 3471 (1997).
50. Supplemental information is available at www. sciencemag.org/feature/data/1044763.shl.
51. A. N. Monteiro, A. August, H. Hanafusa, Proc. Natl. Acad. Sci. U.S.A. 93, 13595 (1996).
52. C. Barlow, M. A. Eckhaus, A. A. Schaffer, A. Wynshaw-Boris, Nature Genet 21, 359 (1999).
53. Q, Liu, M. Z. Li, D. Leibham, D. Cortez, S. J. Elledge, Curr. Biol. 8, 1300 (1998).
54. W. S. Pear, G. P. Nolan, M. L. Scott, D. Baltimore. Proc. Natl. Acad. Sci. U.S.A. 90, 8392 (1993).
55. G. E. Tomlinson et al., Cancer Res. 58, 3237 (1998).
56. M. Goggins et al., Cancer Res. 56, 5360 (1996).
57. Y. Ziv et al., Oncogene 15, 159 (1997).
58. ACAATTAGCCG and GAAAGGTCGACGGACTCTAA-TTTCTTGGCCCCTC; pDC114 (Brcal 1211 to 1351), GAAAGGACCAGTCCTCAGAAGAGAACTTATCTAG and GAAAGGTCGACCAAGCCCGTTCCTCTTTCTT-CATC; and pDC115 (Brcal 1351 to 1552), GAAA-GGATCCGCT TGGAAGAAAATAATCAAGAAGA and GAAAGGTCGACGTAAGATGTTTCCGTCAAATCGTG. In vitro kinase assays were performed essentially as described (9). The ATM expression constructs were a kind gift of M. Kastan.
59. X. Zhang et al., Anal. Chem. 70, 2050 (1998).
60. K. Biemann, Biomed. Environ. Mass Spectrum. 16, 99 (1988).
61. Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, lle; K. Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser: T, Thr; V, Val; W, Trp; and Y, Tyr.
62. Flag-tagged NLS-Brca1 1351 to 1552 was constructed with the univector plasmid fusion system (29). The host vector is based on pCMV2-Flag (Sigma). The SV40 large T antigen NLS was inserted between the Hind III and Not I sites with the following primers; AGCTTCCCAA-GAAGAAGAGGAAGGC and GGCCGCCTTCCTCTTCT-TCTTGGGA. pUN115 Brca1 1351 to 1552 was made with the same primers as those for pDC115 described above. The serine to alanine mutations were made by single-stranded mutagenesis with the following primers: S1423A. AWGCATGGGGCCCAGCCTTCTAACAG; and 51524A, AAACTACCCAGCTCAAGAGGAACTCAT-TAAGGTTGTT. All mutations and PCR products were sequenced. Transfections were performed by standard calcium phosphate technique (30).
63. pBABEpuro HABrca1 was made by digesting pCDNA3βHABrca1 (76) with Sal I and Xho I and inserting it into the Sal I site of pBABEpuro. The serine to alanine mutations were inserted into wild-type Brcal in pBABEpuro by exchanging a Pfl MI to Apa I Brca1 fragment from the mutated gene into pBABEpuro HABrca wild type. This deletes a portion of Brca1 because an Apa I site had been created by the introduction of the S1423A mutation. This deleted Brca1 segment was reintroduced as an Apa I to Apa I fragment derived from the full-length S1423A/S1524A mutant in pBSKII(-) reconstituting full-length HABrca1 S1423A/ S1S24A Retrovirus was made by cotransfection of the pBABEpuro vectors with amphotrophic packaging DNA into 293T cells essentially as described (30). Viral supernatants were used to infect the HCC1937 cells. Two days after infection, cells were selected for puromycin resistance with puromycin (1 μg/ml; Sigma).
64. We thank D. Livingston, R. Scully, M. Kastan, and Y. Shiloh for providing reagents and M. Huang for helpful comments on the manuscript. D.C. is a Fellow of the Jane Coffin Childs Memorial Fund for Medical Research. This work was supported by grants GM44664 and Q1187 (Welch) to S.J.E. and grant IRG199A (American Cancer Society) and a grant from the L.E. Gordy Cancer Research Fund to J.Q. S.J.E is an Investigator with the Howard Hughes Medical Institute.