Inactivation of misselected CD8 T cells by CD8 gene methylation and cell death

Science

Volumn 284, Issue 5417, 1999, Pages 1187-1191

  Pestano, Gary A ^a   Zhou, Yaling ^a   Trimble, Linda A ^a   Daley, John ^a   Weber, Georg F ^a   Cantor, Harvey ^a  

^a HARVARD MEDICAL SCHOOL   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

FAS ANTIGEN; FAS LIGAND; MAJOR HISTOCOMPATIBILITY ANTIGEN CLASS 1; T LYMPHOCYTE RECEPTOR;

ANIMAL CELL; ARTICLE; AUTOIMMUNE DISEASE; CELL DEATH; CELL SURVIVAL; GENE EXPRESSION; LYMPHOCYTE ACTIVATION; METHYLATION; MOUSE; NONHUMAN; PRIORITY JOURNAL; SIGNAL TRANSDUCTION; T LYMPHOCYTE SUBPOPULATION; THYMUS;

ADOPTIVE TRANSFER; ANIMALS; ANTIGENS, CD8; ANTIGENS, CD95; APOPTOSIS; CD8-POSITIVE T-LYMPHOCYTES; DNA METHYLATION; FAS LIGAND PROTEIN; GENE EXPRESSION REGULATION; GRANZYMES; HISTOCOMPATIBILITY ANTIGENS CLASS I; KRUPPEL-LIKE TRANSCRIPTION FACTORS; LYMPHOCYTE COUNT; MEMBRANE GLYCOPROTEINS; MICE; MICE, INBRED C57BL; RECEPTORS, ANTIGEN, T-CELL; SERINE ENDOPEPTIDASES; THYMUS GLAND; TRANS-ACTIVATORS; UP-REGULATION;

ANIMALIA;

EID: 0033553620     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.284.5417.1187     Document Type: Article

References (53)

1. S. C. Jameson and M. J. Bevan, Curr. Opin. Immunol. 10, 214 (1998); P. Marrack and J. W. Kappler, ibid. 9, 250 (1997); H. von Boehmer, ibid., p. 263; A. Volkmann, T. Barthlott, S. Weiss, R. Frank, B. Stockinger, J. Exp. Med. 188, 1083 (1998); M. A. Basson, U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska, ibid. 187, 1249 (1998).
2. S. C. Jameson and M. J. Bevan, Curr. Opin. Immunol. 10, 214 (1998); P. Marrack and J. W. Kappler, ibid. 9, 250 (1997); H. von Boehmer, ibid., p. 263; A. Volkmann, T. Barthlott, S. Weiss, R. Frank, B. Stockinger, J. Exp. Med. 188, 1083 (1998); M. A. Basson, U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska, ibid. 187, 1249 (1998).
3. S. C. Jameson and M. J. Bevan, Curr. Opin. Immunol. 10, 214 (1998); P. Marrack and J. W. Kappler, ibid. 9, 250 (1997); H. von Boehmer, ibid., p. 263; A. Volkmann, T. Barthlott, S. Weiss, R. Frank, B. Stockinger, J. Exp. Med. 188, 1083 (1998); M. A. Basson, U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska, ibid. 187, 1249 (1998).
4. S. C. Jameson and M. J. Bevan, Curr. Opin. Immunol. 10, 214 (1998); P. Marrack and J. W. Kappler, ibid. 9, 250 (1997); H. von Boehmer, ibid., p. 263; A. Volkmann, T. Barthlott, S. Weiss, R. Frank, B. Stockinger, J. Exp. Med. 188, 1083 (1998); M. A. Basson, U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska, ibid. 187, 1249 (1998).
5. S. C. Jameson and M. J. Bevan, Curr. Opin. Immunol. 10, 214 (1998); P. Marrack and J. W. Kappler, ibid. 9, 250 (1997); H. von Boehmer, ibid., p. 263; A. Volkmann, T. Barthlott, S. Weiss, R. Frank, B. Stockinger, J. Exp. Med. 188, 1083 (1998); M. A. Basson, U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska, ibid. 187, 1249 (1998).
6. E. Matechak, N. Killeen, S. Hedrick, B. J. Fowlkes, Immunity 4, 337 (1996).
7. E. Robey et al., Cell 87, 483 (1996).
8. R. J. Schulz, A. Parkes, E. Mizoguchi, A. Bhan, S. Koyasu, J. Immunol. 157, 4379 (1996).
9. J. Kirberg et al., J. Exp. Med. 180, 25 (1994).
10. A. Rao, W. J. Allard., P. G. Hogan, R. S. Rosenson, H. Cantor, Immunogenetics 17, 147 (1983); H. Suzuki et al. J. Immunol. 153, 4496 (1994).
11. A. Rao, W. J. Allard., P. G. Hogan, R. S. Rosenson, H. Cantor, Immunogenetics 17, 147 (1983); H. Suzuki et al. J. Immunol. 153, 4496 (1994).
12. K. M. Murphy, A. B. Heimberger, D. Y. Loh, Science 250, 1720 (1990); K. Haskins et al., J. Exp. Med. 157, 1149 (1983); K. Iwabuchi et al., Proc. Natl. Acad Sci. U.S.A. 89, 9000 (1992); E. R. Kearney, K. A. Pope, D. Y. Loh, M. K. Jenkins, Immunity 1, 327 (1994).
13. K. M. Murphy, A. B. Heimberger, D. Y. Loh, Science 250, 1720 (1990); K. Haskins et al., J. Exp. Med. 157, 1149 (1983); K. Iwabuchi et al., Proc. Natl. Acad Sci. U.S.A. 89, 9000 (1992); E. R. Kearney, K. A. Pope, D. Y. Loh, M. K. Jenkins, Immunity 1, 327 (1994).
14. K. M. Murphy, A. B. Heimberger, D. Y. Loh, Science 250, 1720 (1990); K. Haskins et al., J. Exp. Med. 157, 1149 (1983); K. Iwabuchi et al., Proc. Natl. Acad Sci. U.S.A. 89, 9000 (1992); E. R. Kearney, K. A. Pope, D. Y. Loh, M. K. Jenkins, Immunity 1, 327 (1994).
15. K. M. Murphy, A. B. Heimberger, D. Y. Loh, Science 250, 1720 (1990); K. Haskins et al., J. Exp. Med. 157, 1149 (1983); K. Iwabuchi et al., Proc. Natl. Acad Sci. U.S.A. 89, 9000 (1992); E. R. Kearney, K. A. Pope, D. Y. Loh, M. K. Jenkins, Immunity 1, 327 (1994).
16. P. Kisielow, H. Bluthmann, U. D. Staerz, M. Steinmetz, H. von Boehmer, Nature 333, 742 (1988).
17. G. A. Pestano and H. Cantor, unpublished data.
18. 4) CD8 cells per mouse (20 mice were analyzed).
19. T. Preckel et al., Eur. J. Immunol. 28, 3706 (1998); B. K. Cho, C. Wang, S. Sugawa, H. N. Eisen, J. Chen, Proc. Natl. Acad. Sci. U.S.A. 96, 2976 (1999).
20. T. Preckel et al., Eur. J. Immunol. 28, 3706 (1998); B. K. Cho, C. Wang, S. Sugawa, H. N. Eisen, J. Chen, Proc. Natl. Acad. Sci. U.S.A. 96, 2976 (1999).
21. -/- mice (0.32 ± 0.18 to 0.02 ± 0.03). The expression of GAPDH (0.4 ± 0.03 to 0.4 ± 0.01) and Thy1.2 (0.6 ± 0.02 to 0.6 ± 0.01) was virtually identical in CD8 cells from either strain of mouse, and transcripts for CD4 were always undetectable. RT- PCR was performed on equalized RNA samples from the respective cell samples, and densitometric scans were conducted on a digital imaging system (IS-1000, Alpha Innotech, San Leandro, CA) after the exposure of ethidium bromide-stained agarose gels to ultraviolet irradiation. Relative gene expression was determined with PCR products recovered from the linear phase of amplification as described (24). To ensure that comparisons were based on the same amount of RNA in each sample, we divided the area under the densitometric peak for each gene by the area under the β-actin densitometric peak for the same cellular RNA as previously described (25). The ratio of each gene product level to that of actin in the same sample is expressed in relative densitometric units. The data given are the means ± SD of three independent experiments. LKLF (13) was detected with CCCTCGTCCCCTGGAGCTGCT and GAACGTGC- CACAGTCGCGCAT (376 bp) FasL (537 bp) [K. Benedikt et al., J. Immunol. 161, 6939 (1998)]; Thy 1.2 was detected with TGACCAGCCTGACAGC- CTGCC and TTGGAGGAGGGAGAGGCAAAGC (401 bp), granzyme B (319 bp) (26), and GAPDH (950 bp) (Clontech, Palo Alto, CA).
22. C. T. Kuo, M. L. Veselits, J. M. Leiden, Science 277, 1986 (1997).
23. A. M. Carbone, P. Marrack, J. W. Kappler J. Immunol. 141, 1369 (1988); Science 242, 1174 (1988).
24. A. M. Carbone, P. Marrack, J. W. Kappler J. Immunol. 141, 1369 (1988); Science 242, 1174 (1988).
25. C. Tanchot, F. A. Lemonnier, B. Pérarnau, A. A. Freitas, B. Rocha, Science 276, 2057 (1997); D. Nesic and J. Vukmanovic, J. Immunol. 160, 3705 (1998); H. von Boehmer, A. Sarukhan, J. Buer, Immunologist 5/6, 185 (1997).
26. C. Tanchot, F. A. Lemonnier, B. Pérarnau, A. A. Freitas, B. Rocha, Science 276, 2057 (1997); D. Nesic and J. Vukmanovic, J. Immunol. 160, 3705 (1998); H. von Boehmer, A. Sarukhan, J. Buer, Immunologist 5/6, 185 (1997).
27. C. Tanchot, F. A. Lemonnier, B. Pérarnau, A. A. Freitas, B. Rocha, Science 276, 2057 (1997); D. Nesic and J. Vukmanovic, J. Immunol. 160, 3705 (1998); H. von Boehmer, A. Sarukhan, J. Buer, Immunologist 5/6, 185 (1997).
28. -/- mice. Data represent the mean values of 10 individual mice analyzed in three separate experiments.
29. R. Watanabe-Fukunaga et al., Nature 356, 314 (1992); D. H. Lynch et al., Immunity 1, 131 (1994).
30. R. Watanabe-Fukunaga et al., Nature 356, 314 (1992); D. H. Lynch et al., Immunity 1, 131 (1994).
31. lpr mice underwent replication in the same experiments, which is consistent with earlier findings that these cells, once formed, are quiescent [E. S. Sobel, V. N. Kakkanaiah, R. C. Rapoport, R. A. Eisenberg, P. L Cohen, Clin, Immunol. Immunopathol. 74, 177 (1995)].
32. lpr mice underwent replication in the same experiments, which is consistent with earlier findings that these cells, once formed, are quiescent [E. S. Sobel, V. N. Kakkanaiah, R. C. Rapoport, R. A. Eisenberg, P. L Cohen, Clin, Immunol. Immunopathol. 74, 177 (1995)].
33. 51Cr-labeled RMA tumor cells to each well. Anti-H-Y CD8 cells that had been incubated with RMA tumor cells for 3 days contained 48% apoptotic cells and lysed 90 to 100% of target (RMA) cells [effectortarget (E:T) ratio, 5:1]; in contrast, anti-H-Y CD8 cells that had been incubated with (class l-deficient) RMA-S cells far 3 days contained 86% apoptotic cells and lysed 0 to 30% of tumor target cells at 5:1 or 10:1 E:T ratios.
34. 51Cr-labeled RMA tumor cells to each well. Anti-H-Y CD8 cells that had been incubated with RMA tumor cells for 3 days contained 48% apoptotic cells and lysed 90 to 100% of target (RMA) cells [effectortarget (E:T) ratio, 5:1]; in contrast, anti-H-Y CD8 cells that had been incubated with (class l-deficient) RMA-S cells far 3 days contained 86% apoptotic cells and lysed 0 to 30% of tumor target cells at 5:1 or 10:1 E:T ratios.
35. D. L Perkins et al., J. Immunol. 156, 4961 (1996).
36. M. A. Maldonado, R. A. Eisenberg, E. Roper, P. L Cohen, B. L. Kotzin, J. Exp. Med. 181, 64 (1995); D. R. Koh et al., Cur. J. Immunol. 25, 2558 (1995); A. M. Jevnikar et al., J. Exp. Med. 179, 1137 (1994).
37. M. A. Maldonado, R. A. Eisenberg, E. Roper, P. L Cohen, B. L. Kotzin, J. Exp. Med. 181, 64 (1995); D. R. Koh et al., Cur. J. Immunol. 25, 2558 (1995); A. M. Jevnikar et al., J. Exp. Med. 179, 1137 (1994).
38. M. A. Maldonado, R. A. Eisenberg, E. Roper, P. L Cohen, B. L. Kotzin, J. Exp. Med. 181, 64 (1995); D. R. Koh et al., Cur. J. Immunol. 25, 2558 (1995); A. M. Jevnikar et al., J. Exp. Med. 179, 1137 (1994).
39. T. M. Laufer, J. DeKoning, J. S. Markowitz, D. Lo, L H. Glimcher, Nature 383, 81 (1996); D. H. Chung et al., Hum. Immunol. 45, 124 (1996).
40. T. M. Laufer, J. DeKoning, J. S. Markowitz, D. Lo, L H. Glimcher, Nature 383, 81 (1996); D. H. Chung et al., Hum. Immunol. 45, 124 (1996).
41. P. L Cohen and R. A. Eisenberg, Annu. Rev. Immunol. 9, 243 (1991); M. S. Lim et al., Am. J. Pathol. 153, 1541 (1998); B. S. Devi, S. van Noordin, T. Krausz, K. A. Davies, J. Autoimmun. 11, 471 (1998); F. Le Deist et al., Lancet 348, 719 (1996).
42. P. L Cohen and R. A. Eisenberg, Annu. Rev. Immunol. 9, 243 (1991); M. S. Lim et al., Am. J. Pathol. 153, 1541 (1998); B. S. Devi, S. van Noordin, T. Krausz, K. A. Davies, J. Autoimmun. 11, 471 (1998); F. Le Deist et al., Lancet 348, 719 (1996).
43. P. L Cohen and R. A. Eisenberg, Annu. Rev. Immunol. 9, 243 (1991); M. S. Lim et al., Am. J. Pathol. 153, 1541 (1998); B. S. Devi, S. van Noordin, T. Krausz, K. A. Davies, J. Autoimmun. 11, 471 (1998); F. Le Deist et al., Lancet 348, 719 (1996).
44. P. L Cohen and R. A. Eisenberg, Annu. Rev. Immunol. 9, 243 (1991); M. S. Lim et al., Am. J. Pathol. 153, 1541 (1998); B. S. Devi, S. van Noordin, T. Krausz, K. A. Davies, J. Autoimmun. 11, 471 (1998); F. Le Deist et al., Lancet 348, 719 (1996).
45. PCR primers were selected to span exons and to yield similarly sized single-band products. Sense and antisense primers, respectively, were as follows: β-actin, GACTACCTCATGAAGATCCT and CTAGAAGCACTT- GCGGTGCAC (570 bp); CD8α, GCCAGAAGGTGGAC- CTGGTATGTG and GAGTGATGATCAAGGACAGCA- GAAG (498 bp); CD8β, ATGCAGCCATGGCTCTG- GCTGG and GCATGTCAGGCCCTTCTGGGTC (512 bp); and TCR Cβ, CCCACTATTTTTCTTCCTTCTGTT- GCTGAA and TTTGTTGTTCTCATGTTTGACAATAC- A-ACT (255 bp). CD4 transcripts (615 bp) (Clontech) were always undetectable (9) [X. F. Yang, G. F. Weber, H. Cantor, Immunity 7, 629 (1997)].
46. R. Patarca, F.-Y. Wei, P. Singh, M. I. Morasso, H. Cantor.J. Exp. Med. 172, 1177 (1990).
47. K. Ebnet, J. Chluba-de Tapia, U. Hurtenbach, M. D. Kramer, M. M. Simon, Int. Immunol. 3, 9 (1991).
48. A. L. Crump, M. J. Grusby, L. H. Glimcher, H. Cantor. Proc. Natl. Acad. Sci. U.S.A. 90, 10739 (1993).
49. 7 DN cells.
50. b-/-) host spleen cells indicated that the potential MHC difference did not affect the response of the donor cells.
51. + before transfer into adoptive syngeneic hosts.
52. T. Manlatis and E. F. Fritsch, Molecular Cloning: A laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1982).
53. We thank H.-S. Teh for the antibody to TCR H-Y, T3.70; P. Marrack for KJ1-26.1 hybridoma (anti- DO11.10 TCR); A. Sharpe for DO11.10 TCR transgenic mice; I. Rimm for the lpr/lpr mutant mice expressing the DO11.10 TCR transgene; G. Stella and X.-f. Yang for advice with the semiquantitative RT- PCR; and A. Angel and K. MacKay for assistance in the preparation of this manuscript. All work involving animals was conducted under protocols approved by the Animal Care and Use Committee at Dana Farber Cancer Institute. Supported by NIH basic research grants CA76176 to G.F.W. and Al 13600 and Al 37833 to H.C.