Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant

Science

Volumn 279, Issue 5349, 1998, Pages 389-393

  Winkler, Cheryl ^a   Modi, William ^a   Smith, Michael W ^a   Nelson, George W ^a   Wu, Xueyun ^a   Carrington, Mary ^a   Dean, Michael ^b   Honjo, Tasaku ^c   Tashiro, Kai ^c   Yabe, D ^c   Buchbinder, Susan ^d   Vittinghoff, Eric ^d   Goedert, James J ^e   O'Brien, Thomas R ^e   Jacobson, Lisa P ^f   Detels, Roger ^g   Donfield, Sharyne ^h   Willoughby, Anne ⁱ   Gomperts, Edward ^j   Vlahov, David ^f   Phair, John ^k   O'Brien, Stephen J ^b   more..

^a SAIC FREDERICK INC   (United States)

^b NATIONAL CANCER INSTITUTE   (United States)

^c KYOTO UNIVERSITY   (Japan)

^d AIDS Office San Francisco   (United States)

^e NATIONAL CANCER INSTITUTE   (United States)

^f JOHNS HOPKINS BLOOMBERG SCHOOL OF PUBLIC HEALTH   (United States)

^g UNIVERSITY OF CALIFORNIA   (United States)

^h RHO INC   (United States)

ⁱ EUNICE KENNEDY SHRIVER NATIONAL INSTITUTE OF CHILD HEALTH AND HUMAN DEVELOPMENT   (United States)

^j CHILDREN S HOSPITAL LOS ANGELES   (United States)

^k NORTHWESTERN UNIVERSITY   (United States)

more..

Author keywords

[No Author keywords available]

Indexed keywords

CHEMOKINE;

ACQUIRED IMMUNE DEFICIENCY SYNDROME; ARTICLE; GENETIC POLYMORPHISM; LYMPHOCYTE SUBPOPULATION; MUTATION; PATHOGENESIS; PRIORITY JOURNAL;

ACQUIRED IMMUNODEFICIENCY SYNDROME; ADULT; CHEMOKINES; CHEMOKINES, CXC; COHORT STUDIES; CONTINENTAL POPULATION GROUPS; DISEASE PROGRESSION; GENES; GENOTYPE; HETEROZYGOTE; HIV INFECTIONS; HIV-1; HUMANS; MALE; MOLECULAR SEQUENCE DATA; ODDS RATIO; POLYMORPHISM, GENETIC; RECEPTORS, CCR5; RECEPTORS, CHEMOKINE; RECEPTORS, CXCR4; SURVIVAL ANALYSIS; T-LYMPHOCYTES; VARIATION (GENETICS);

EID: 7144225541     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.279.5349.389     Document Type: Article

References (72)

1. M. P. D'Souza and V. A. Harden, Nature Med. 2, 1293 (1996); B. A. Premack and T. J. Schall, ibid., p. 1174; J. M. McNicholl et al., Emerg. Infect. Dis. 3, 261 (1997).
2. M. P. D'Souza and V. A. Harden, Nature Med. 2, 1293 (1996); B. A. Premack and T. J. Schall, ibid., p. 1174; J. M. McNicholl et al., Emerg. Infect. Dis. 3, 261 (1997).
3. M. P. D'Souza and V. A. Harden, Nature Med. 2, 1293 (1996); B. A. Premack and T. J. Schall, ibid., p. 1174; J. M. McNicholl et al., Emerg. Infect. Dis. 3, 261 (1997).
4. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
5. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
6. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
7. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
8. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
9. G. Alkhatib et al., Science 272, 1955 (1996); H. Deng et al., Nature 381, 661 (1996); T. Dragic et al., ibid., p. 667; H. Choe et al., Cell 85, 1135 (1996); B. J. Doranz et al., ibid., p. 1149; J. Rucker et al., ibid. 87, 437 (1996).
10. A. S. Fauci, Nature 384, 529 (1996); R. A. Weiss, Science 272, 1885 (1996).
11. A. S. Fauci, Nature 384, 529 (1996); R. A. Weiss, Science 272, 1885 (1996).
12. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
13. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
14. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
15. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
16. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
17. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
18. R. I. Connor et al., J. Exp. Med. 185, 621 (1997); H. Schuitemaker et al., J. Virol. 64, 356 (1991); H. Schuitemaker et al., ibid. 66, 1354 (1992); B. Asjo, Lancet ii, 660 (1986); R. I. Connor, H. Mohri, Y. Cao, D. D. Ho, J. Virol. 67, 1772 (1993); M. T. Roos et al., J. Infect. Dis. 165, 427 (1992); T. Zhu et al., Science 261, 1179 (1993).
19. Y. Feng, C. C. Broder, P. E. Kennedy, E. A. Berger, Science 272, 872 (1996); C. C. Bluel et al., Nature 382, 829 (1996); E. O'Berlin et al., ibid., p. 833; C. C. Bluel et al., J. Exp. Med. 184, 1101 (1996); A. Amaru et al., ibid. 186, 139 (1997).
20. Y. Feng, C. C. Broder, P. E. Kennedy, E. A. Berger, Science 272, 872 (1996); C. C. Bluel et al., Nature 382, 829 (1996); E. O'Berlin et al., ibid., p. 833; C. C. Bluel et al., J. Exp. Med. 184, 1101 (1996); A. Amaru et al., ibid. 186, 139 (1997).
21. Y. Feng, C. C. Broder, P. E. Kennedy, E. A. Berger, Science 272, 872 (1996); C. C. Bluel et al., Nature 382, 829 (1996); E. O'Berlin et al., ibid., p. 833; C. C. Bluel et al., J. Exp. Med. 184, 1101 (1996); A. Amaru et al., ibid. 186, 139 (1997).
22. Y. Feng, C. C. Broder, P. E. Kennedy, E. A. Berger, Science 272, 872 (1996); C. C. Bluel et al., Nature 382, 829 (1996); E. O'Berlin et al., ibid., p. 833; C. C. Bluel et al., J. Exp. Med. 184, 1101 (1996); A. Amaru et al., ibid. 186, 139 (1997).
23. Y. Feng, C. C. Broder, P. E. Kennedy, E. A. Berger, Science 272, 872 (1996); C. C. Bluel et al., Nature 382, 829 (1996); E. O'Berlin et al., ibid., p. 833; C. C. Bluel et al., J. Exp. Med. 184, 1101 (1996); A. Amaru et al., ibid. 186, 139 (1997).
24. M. Shirozu et al., Genomics 28, 495 (1995); K. Tashiro et al., Science 261, 600 (1993).
25. M. Shirozu et al., Genomics 28, 495 (1995); K. Tashiro et al., Science 261, 600 (1993).
26. PCR products were run out using two conditions: (i) 6% acrylamide (acrylamide:bisacrylamide, 37.5:1), 4°C at 50 W for 3.5 hours, and (ii) 5% acrylamide (acrylamide: bisacrylamide, 19:1), room temperature at 40 W for 4 to 6 hours. Both conditions used 1× tris-boric acid-EDTA buffer [M. White et al., Genomics 12, 301 (1992); M. Ravnik-Glavac et al., Hum. Mol. Genet. 3, 801 (1994); M. Orita et al., Genomics 5, 874 (1989)]. The following primers were used: 5′UTR (197 bp), GGCAGGTGGCGAGCTTGAGC (forward) and CTGGAGGGCCGCTTATTGTC (reverse); exon 1 (130 bp), AGCCGCATTGCCCGCTCGGCGTC (F) and CGTCGCTGAGGCAGAGCGCGGTC (R); exon 2 (218 bp), CAAAATCTGACAGGGTAGTA (F) and TCGTTAGATGCAACTATGTTC (R); exon 3 (189 bp), AGCCGCGCTTTCCTCCTGTGC (F) and TAGTTTTCCTCGAGTGGGTC (R); exon 4 (318 bp), CTGTCCTGCTGGAGCTGGC (F) and TTTCAGAGCTGGGCTCCTAC (R); 3′UTR (302 bp), CAGTCAACCTGGGCAAAGCC (F) and AGCTTTGGTCCTGAGAGTCC (R).
27. PCR products were run out using two conditions: (i) 6% acrylamide (acrylamide:bisacrylamide, 37.5:1), 4°C at 50 W for 3.5 hours, and (ii) 5% acrylamide (acrylamide: bisacrylamide, 19:1), room temperature at 40 W for 4 to 6 hours. Both conditions used 1× tris-boric acid-EDTA buffer [M. White et al., Genomics 12, 301 (1992); M. Ravnik-Glavac et al., Hum. Mol. Genet. 3, 801 (1994); M. Orita et al., Genomics 5, 874 (1989)]. The following primers were used: 5′UTR (197 bp), GGCAGGTGGCGAGCTTGAGC (forward) and CTGGAGGGCCGCTTATTGTC (reverse); exon 1 (130 bp), AGCCGCATTGCCCGCTCGGCGTC (F) and CGTCGCTGAGGCAGAGCGCGGTC (R); exon 2 (218 bp), CAAAATCTGACAGGGTAGTA (F) and TCGTTAGATGCAACTATGTTC (R); exon 3 (189 bp), AGCCGCGCTTTCCTCCTGTGC (F) and TAGTTTTCCTCGAGTGGGTC (R); exon 4 (318 bp), CTGTCCTGCTGGAGCTGGC (F) and TTTCAGAGCTGGGCTCCTAC (R); 3′UTR (302 bp), CAGTCAACCTGGGCAAAGCC (F) and AGCTTTGGTCCTGAGAGTCC (R).
28. PCR products were run out using two conditions: (i) 6% acrylamide (acrylamide:bisacrylamide, 37.5:1), 4°C at 50 W for 3.5 hours, and (ii) 5% acrylamide (acrylamide: bisacrylamide, 19:1), room temperature at 40 W for 4 to 6 hours. Both conditions used 1× tris-boric acid-EDTA buffer [M. White et al., Genomics 12, 301 (1992); M. Ravnik-Glavac et al., Hum. Mol. Genet. 3, 801 (1994); M. Orita et al., Genomics 5, 874 (1989)]. The following primers were used: 5′UTR (197 bp), GGCAGGTGGCGAGCTTGAGC (forward) and CTGGAGGGCCGCTTATTGTC (reverse); exon 1 (130 bp), AGCCGCATTGCCCGCTCGGCGTC (F) and CGTCGCTGAGGCAGAGCGCGGTC (R); exon 2 (218 bp), CAAAATCTGACAGGGTAGTA (F) and TCGTTAGATGCAACTATGTTC (R); exon 3 (189 bp), AGCCGCGCTTTCCTCCTGTGC (F) and TAGTTTTCCTCGAGTGGGTC (R); exon 4 (318 bp), CTGTCCTGCTGGAGCTGGC (F) and TTTCAGAGCTGGGCTCCTAC (R); 3′UTR (302 bp), CAGTCAACCTGGGCAAAGCC (F) and AGCTTTGGTCCTGAGAGTCC (R).
29. M. Dean et al. Science 273, 1856 (1996).
30. M. W. Smith et al., ibid. 277, 959 (1997).
31. R. Kaslow et al., Am. J. Epidemiol. 126, 310 (1987); J. Phair et al., J. Acquired Immune Defic. Syndr. 5. 490 (1992); R. Detels et al., ibid. 7, 1263 (1994). MACS principal investigators include A. Saah, A. Munoz, and J. Margolick (Johns Hopkins School of Public Health), J. Phair (Northwestern University Medical School), R. Detels and J. V. Giorgi (University of California, Los Angeles), and C. Rinaldo (University of Pittsburgh). The study was funded by National Institute of Allergy and Infectious Diseases cooperative agreements Uo1-Ai-35042, 5-Mo1-Rr-00722(Gcrc), Uo1-Ai-35043, Uo1-Ai-37984, Uo1-Ai-35039, Uo1-Ai-35040, Uo1-A1-37613, and Uo1-Ai-35041.
32. R. Kaslow et al., Am. J. Epidemiol. 126, 310 (1987); J. Phair et al., J. Acquired Immune Defic. Syndr. 5. 490 (1992); R. Detels et al., ibid. 7, 1263 (1994). MACS principal investigators include A. Saah, A. Munoz, and J. Margolick (Johns Hopkins School of Public Health), J. Phair (Northwestern University Medical School), R. Detels and J. V. Giorgi (University of California, Los Angeles), and C. Rinaldo (University of Pittsburgh). The study was funded by National Institute of Allergy and Infectious Diseases cooperative agreements Uo1-Ai-35042, 5-Mo1-Rr-00722(Gcrc), Uo1-Ai-35043, Uo1-Ai-37984, Uo1-Ai-35039, Uo1-Ai-35040, Uo1-A1-37613, and Uo1-Ai-35041.
33. R. Kaslow et al., Am. J. Epidemiol. 126, 310 (1987); J. Phair et al., J. Acquired Immune Defic. Syndr. 5. 490 (1992); R. Detels et al., ibid. 7, 1263 (1994). MACS principal investigators include A. Saah, A. Munoz, and J. Margolick (Johns Hopkins School of Public Health), J. Phair (Northwestern University Medical School), R. Detels and J. V. Giorgi (University of California, Los Angeles), and C. Rinaldo (University of Pittsburgh). The study was funded by National Institute of Allergy and Infectious Diseases cooperative agreements Uo1-Ai-35042, 5-Mo1-Rr-00722(Gcrc), Uo1-Ai-35043, Uo1-Ai-37984, Uo1-Ai-35039, Uo1-Ai-35040, Uo1-A1-37613, and Uo1-Ai-35041.
34. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
35. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
36. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
37. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
38. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
39. S. P. Buchbinder, AIDS 8, 1123 (1994); K.-J. Lui et al., Science 240, 1333 (1988); M. W. Hilgartner et al., Am. J. Pediatr. Hematol. Oncol. 15, 208 (1993); J. J. Goedert et al., N. Engl. J. Med. 321, 1141 (1989); M. M. Lederman et al., J. Infect. Dis. 172, 228 (1995); D. Vlahov et al., NIDA Research Monograph Series 103 (Public Health Service, Alcohol and Drug Abuse Administration, Washington, DC, 1991). The last of these sources describes the ALIVE cohort, including intravenous drug users and predominantly (94%) African Americans.
40. Additional analysis and data can be inspected at rex.nci.nih.gov/RESEARCH/basic/lgd/Front_page. htm.
41. Y. Huang et al., Nature Med. 2, 1240 (1996); R. Detels et al., AIDS 10, 102 (1996).
42. Y. Huang et al., Nature Med. 2, 1240 (1996); R. Detels et al., AIDS 10, 102 (1996).
43. D. R. Cox, J. R. Stat. Soc. B 34, 187 (1972); Propertional Hazard Regression (PHREG), SAS Release 6.10 (Sas Institute Inc., Cary, NC); D. R. Cox and D. Oakes, Analysis of Survival Data (Chapman & Hall, London, 1984), p. 36; E. Marubini and M. G. Valsecchi, Analysing Survival Data for Clinical Trials and Observational Studies (Wiley, New York, 1995), p. 160.
44. D. R. Cox, J. R. Stat. Soc. B 34, 187 (1972); Propertional Hazard Regression (PHREG), SAS Release 6.10 (Sas Institute Inc., Cary, NC); D. R. Cox and D. Oakes, Analysis of Survival Data (Chapman & Hall, London, 1984), p. 36; E. Marubini and M. G. Valsecchi, Analysing Survival Data for Clinical Trials and Observational Studies (Wiley, New York, 1995), p. 160.
45. D. R. Cox, J. R. Stat. Soc. B 34, 187 (1972); Propertional Hazard Regression (PHREG), SAS Release 6.10 (Sas Institute Inc., Cary, NC); D. R. Cox and D. Oakes, Analysis of Survival Data (Chapman & Hall, London, 1984), p. 36; E. Marubini and M. G. Valsecchi, Analysing Survival Data for Clinical Trials and Observational Studies (Wiley, New York, 1995), p. 160.
46. D. R. Cox, J. R. Stat. Soc. B 34, 187 (1972); Propertional Hazard Regression (PHREG), SAS Release 6.10 (Sas Institute Inc., Cary, NC); D. R. Cox and D. Oakes, Analysis of Survival Data (Chapman & Hall, London, 1984), p. 36; E. Marubini and M. G. Valsecchi, Analysing Survival Data for Clinical Trials and Observational Studies (Wiley, New York, 1995), p. 160.
47. Seroconverter patients included 867 subjects with a maximum interval of 3 years between an HIV-1 antibody-negative test date and their first HIV-1 antibody-positive test date. Seroconversion date was the midpoint between the last HIV-1 antibody-negative and first positive clinic visits. Ninety patients enrolled in the SFCC study before 31 December 1980 were included using imputed seroconversion dates based on their date of first HIV-1 antibody-positive test, because the likelihood of infection before 1 January 1978 (a 3-year window of infection) was extremely low (≤0.01). Seroconversion dates for the imputed SFCC subjects were set at 60 days, 120 days, and 180 days before the date for first antibody-positive visit for patients enrolled in 1978, 1979, and 1980, respectively (11).
48. U.S. Centers for Disease Control, Morb. Mortal. Wkly. Rep. 36 (suppl. 1) (14 August 1987); ibid., 41 (18 December 1992). The latter publication contains a revised classification system for HIV-1 infection and an expanded surveillance case definition for AIDS among adolescents and adults. It went into effect in January 1993.
49. U.S. Centers for Disease Control, Morb. Mortal. Wkly. Rep. 36 (suppl. 1) (14 August 1987); ibid., 41 (18 December 1992). The latter publication contains a revised classification system for HIV-1 infection and an expanded surveillance case definition for AIDS among adolescents and adults. It went into effect in January 1993.
50. The MHCS cohort had 140 seroconverters, of whom four were SDF1-3′A/3′A homozygotes. Two developed AIDS at 8 and 10 years, while the other two have remained AIDS-free for 14 and 15 years after seroconversion. These small numbers render this cohort, when analyzed alone, less informative statistically than larger cohorts, for example, MACS (n = 332 seroconverters) or combined cohorts (n = 857). SFCC, a cohort of homosexual men with a preponderance of long-term survivors, had no deaths among six SDFI -3′A/3′A homozygous seroconverters, making estimates of relative hazard imprecise.
51. Additional evidence in support of an increasing appearance of SDF1-3′A/3′A protection in late stages of HIV-1 infection involves our finding a statistically significant difference in the frequency of homozygotes (FET, P ≤ 0.01) in seroconverter (F = 3.5%; n = 669) versus seroprevalent (F = 6.2%; n = 743) cohort members. The enrichment of homozygotes in seroprevalent individuals is consistent with late-stage protection for two reasons: (i) The seroprevalent group was seropositive at enrollment and therefore included more patients with longer undefined intervals since infection; and (ii) studies may be biased to include more long-term survivors than rapid progressors [M. W. Smith et al., Nature Med. 3, 1052 (1997)]. MACS specifically excluded enrollment of individuals with AIDS-defining conditions, whereas SFCC selected for long-term survivors (10, 11).
52. R. Liu et al., Cell 86, 367 (1996); W. A. Paxton et al., Nature Med. 2, 412 (1996); M. Samson, Nature 382, 722 (1996); N. L. Michael et al., Nature Med. 3, 338 (1997); P. A. Zimmerman et al., Mol. Med. 3, 23 (1997).
53. R. Liu et al., Cell 86, 367 (1996); W. A. Paxton et al., Nature Med. 2, 412 (1996); M. Samson, Nature 382, 722 (1996); N. L. Michael et al., Nature Med. 3, 338 (1997); P. A. Zimmerman et al., Mol. Med. 3, 23 (1997).
54. R. Liu et al., Cell 86, 367 (1996); W. A. Paxton et al., Nature Med. 2, 412 (1996); M. Samson, Nature 382, 722 (1996); N. L. Michael et al., Nature Med. 3, 338 (1997); P. A. Zimmerman et al., Mol. Med. 3, 23 (1997).
55. R. Liu et al., Cell 86, 367 (1996); W. A. Paxton et al., Nature Med. 2, 412 (1996); M. Samson, Nature 382, 722 (1996); N. L. Michael et al., Nature Med. 3, 338 (1997); P. A. Zimmerman et al., Mol. Med. 3, 23 (1997).
56. R. Liu et al., Cell 86, 367 (1996); W. A. Paxton et al., Nature Med. 2, 412 (1996); M. Samson, Nature 382, 722 (1996); N. L. Michael et al., Nature Med. 3, 338 (1997); P. A. Zimmerman et al., Mol. Med. 3, 23 (1997).
57. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
58. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
59. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
60. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
61. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
62. R. Biti et al., Nature Med. 3, 252 (1997); T. R. O'Brien et al., Lancet 349, 1219 (1997); I. Theodorou et al., ibid., p. 1219; N. L. Michael et al., Nature Med. 3, 1160 (1997); M. W. Smith et al., ibid., p. 1052; O. J. Cohen, J. Clin. Invest. 100, 1581 (1997). These papers contain caveats about CCR2 and CCR5 genetic protection.
63. Protective genotypes include CCR2-64I protection (CCR5-+/+, CCR2-+/64I or 64I/64I, and SDF1-+/ +), CCR5-Δ32 protection (CCR5-+/Δ32, CCR2-+/ + , and SDF1-+/+), and SDF1-3′A protection (SDF1-3′A/3′A). Protective genotypes at either CCR5 or CCR2 are referred to as "CCR protection."
64. The null hypothesis of equality of SDF1 and CCR2/ CCR5 protection was tested in a Cox model analysis by comparing a model with a single variable for SDF1 or CCR2/CCR5 protection, corresponding to equality of CCR2/CCR5 and SDF1 protection, with a model containing an additional variable for differential SDF1 protection. For Caucasians in combined cohorts, relative hazards of <1 were shown for the differential SDF1 protection variable for AIDS-1987 and death, indicating stronger protection by SDF1 than by CCR2 or CCR5, with P = 0.04 (AIDS-1987) and P = 0.03 (death). The corresponding values for all ethnic groups were P = 0.03 and P = 0.02.
65. To test for a significant additive effect (that is, for an advantage in having protective genotypes both at the SDF1 locus and at one or both of the CCR loci), we performed a Cox model test with an interaction variable and a single covariable for SDF1 or CCR protection. This test had significant log likelihood P values (P < 0.01) for AIDS-1987 and death for Caucasians in combined cohorts, with relative hazards of 0.31 (AIDS-1987) and 0.0 (death) (no deaths in doubly protected group), showing a significant advantage to having both protective genotypes. As an additional test of the additivity of the interaction between SDF1 and CCR, a Cox model test was performed with separate variables for protection by SDF1 and CCR, plus an interaction variable. The relative hazards of the interaction term were 0.55 (AIDS-1993), 0.31 (AIDS-1987), and 0.0 (death), with the P values falling short of significance (P = 0.13 to 0.31). These results indicate that the nonadditivity in the interaction between SDF1 and CCR protective genotypes is not significant, but that the interaction tends toward being stronger than additive - that is, synergistic.
66. J. Ross, Trends Genet. 12, 171 (1996); K. C. Tsai, V. V. Cansino, D. T. Kohn, R. L. Neve, N. I. Perrone-Bizzozero, J. Neurosci. 17, 1950 (1997); K. M. Mcgowan, S. Police, J. B. Winslow, P. H. Pekala, J. Biol. Chem. 272, 1331 (1997); G. Shaw and R. Kamen, Cell 46, 659 (1986); D. Kube et al., Cytokine 7, 107 (1995).
67. J. Ross, Trends Genet. 12, 171 (1996); K. C. Tsai, V. V. Cansino, D. T. Kohn, R. L. Neve, N. I. Perrone-Bizzozero, J. Neurosci. 17, 1950 (1997); K. M. Mcgowan, S. Police, J. B. Winslow, P. H. Pekala, J. Biol. Chem. 272, 1331 (1997); G. Shaw and R. Kamen, Cell 46, 659 (1986); D. Kube et al., Cytokine 7, 107 (1995).
68. J. Ross, Trends Genet. 12, 171 (1996); K. C. Tsai, V. V. Cansino, D. T. Kohn, R. L. Neve, N. I. Perrone-Bizzozero, J. Neurosci. 17, 1950 (1997); K. M. Mcgowan, S. Police, J. B. Winslow, P. H. Pekala, J. Biol. Chem. 272, 1331 (1997); G. Shaw and R. Kamen, Cell 46, 659 (1986); D. Kube et al., Cytokine 7, 107 (1995).
69. J. Ross, Trends Genet. 12, 171 (1996); K. C. Tsai, V. V. Cansino, D. T. Kohn, R. L. Neve, N. I. Perrone-Bizzozero, J. Neurosci. 17, 1950 (1997); K. M. Mcgowan, S. Police, J. B. Winslow, P. H. Pekala, J. Biol. Chem. 272, 1331 (1997); G. Shaw and R. Kamen, Cell 46, 659 (1986); D. Kube et al., Cytokine 7, 107 (1995).
70. J. Ross, Trends Genet. 12, 171 (1996); K. C. Tsai, V. V. Cansino, D. T. Kohn, R. L. Neve, N. I. Perrone-Bizzozero, J. Neurosci. 17, 1950 (1997); K. M. Mcgowan, S. Police, J. B. Winslow, P. H. Pekala, J. Biol. Chem. 272, 1331 (1997); G. Shaw and R. Kamen, Cell 46, 659 (1986); D. Kube et al., Cytokine 7, 107 (1995).
71. The SDF1 gene contains four exons over a 5.6-kb region of chromosome 10q11.1 (6). Two alternatively spliced transcripts that specify SDF-1 α and SDF-1β are made from the gene; the isomers differ by the addition of four COOH-terminal amino acids from the fourth exon in SDF-1β (6). The two transcripts have completely different 3′UTRs, and the SDF1-3′A mutation is found in the SDF-1β transcript within a sequence block that is conserved between mouse and human SDF-1β UTR sequences. The possibility of linkage disequilibrium tracking of the SDF1-3′A mutation through linkage disequilibrium was investigated first by sequence determination of the four SDF1 coding exons in eight SDF1 3′A/3′A homozygotes. No additional polymorphisms were detected. Further sequence analysis of two SDF1-+/+ homozygotes and two SDF1-3′A/3′A homozygotes for 3253 nucleotides (out of 3524 in the entire transcript) identified two variants (positions 1912 and 2950) in single SDF1-+/+ individuals and revealed no additional mutations tracking with SDF1-3′A.
72. We very gratefully acknowledge the patients, their families, and clinicians who participated in the ALIVE, MACS, MHCS, HGDS, and SFCC cohort studies. We thank E. Binns, R. Boaze, K. Boyd, S. Cevario, K. Gong, D. Hague, A. Houser, L. Kenefic, M. Konsovich, D. Lomb, M. McNally, M. Mylasky, and M. Weedon for excellent technical assistance and D. Lipmann, G. Huttley, G. Smythers, C. Stephens, and J. Wang for helpful discussions. We also thank L. Main for secretarial assistance and the Frederick Biomedical Supercomputing Center for computational resources.