메뉴 건너뛰기




Volumn 292, Issue 5519, 2001, Pages 1151-1153

African origin of modern humans in East Asia: A tale of 12,000 Y chromosomes

(23)  Ke, Yuehai a,b   Su, Bing a,b,c,d   Song, Xiufeng a,b   Lu, Daru a,b   Chen, Lifeng a,b   Li, Hongyu a,b   Qi, Chunjian a,b   Marzuki, Sangkot e   Deka, Ranjan f   Underhill, Peter g   Xiao, Chunjie h   Shriver, Mark i   Lell, Jeff j   Wallace, Douglas j   Wells, R Spencer n   Seielstad, Mark k   Oefner, Peter g   Zhu, Dingliang l   Jin, Jianzhong a,b   Huang, Wei l,m   more..


Author keywords

[No Author keywords available]

Indexed keywords

BIOMARKERS; HUMAN ENGINEERING; MUTAGENESIS; POPULATION STATISTICS;

EID: 0035844029     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.1060011     Document Type: Article
Times cited : (175)

References (31)
  • 4
    • 0028184174 scopus 로고
    • A. M. Bowcock et al., Nature 368, 455 (1994).
    • (1994) Nature , vol.368 , pp. 455
    • Bowcock, A.M.1
  • 5
  • 6
  • 10
    • 0031470484 scopus 로고    scopus 로고
    • M, Krings et al., Cell 90, 19 (1997).
    • (1997) Cell , vol.90 , pp. 19
    • Krings, M.1
  • 11
    • 0343721461 scopus 로고    scopus 로고
    • V. O. Igor et al., Nature 404, 490 (2000).
    • (2000) Nature , vol.404 , pp. 490
    • Igor, V.O.1
  • 16
    • 0030303721 scopus 로고    scopus 로고
    • C. C. Swisher et al., Science 274, 1870 (1996).
    • (1996) Science , vol.274 , pp. 1870
    • Swisher, C.C.1
  • 17
    • 0342416265 scopus 로고    scopus 로고
    • note
    • A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Man Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner-Mongolia, Qinghai, Shaanxi, and Jilin); southern Man Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia (Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru) Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia (Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently.
  • 18
    • 0342851139 scopus 로고    scopus 로고
    • note
    • Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and T ATCTCCTCTTCT AT TGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results.
  • 31
    • 0342851138 scopus 로고    scopus 로고
    • note
    • We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.