메뉴 건너뛰기




Volumn 17, Issue 11, 2008, Pages 2652-2665

Extensive polymorphism and geographical variation at a positively selected MHC class II B gene of the lesser kestrel (Falco naumanni)

Author keywords

Adaptive variation; Balancing selection; Bird of prey; Conservation genetics; Population genetics

Indexed keywords

MICROSATELLITE DNA; MITOCHONDRIAL DNA;

EID: 44249122817     PISSN: 09621083     EISSN: 1365294X     Source Type: Journal    
DOI: 10.1111/j.1365-294X.2008.03791.x     Document Type: Article
Times cited : (109)

References (87)
  • 2
    • 33644884224 scopus 로고    scopus 로고
    • Patterns of variation in MHC class II B loci of the little greenbul (Andropadus virens) with comments on MHC evolution in birds
    • Aguilar A, Edwards SV, Smith TB, Wayne RK (2006) Patterns of variation in MHC class II B loci of the little greenbul (Andropadus virens) with comments on MHC evolution in birds. Journal of Heredity, 97, 133 142.
    • (2006) Journal of Heredity , vol.97 , pp. 133-142
    • Aguilar, A.1    Edwards, S.V.2    Smith, T.B.3    Wayne, R.K.4
  • 3
    • 22744453199 scopus 로고    scopus 로고
    • Extra-pair paternity in the lesser kestrel Falco naumanni: A re-evaluation using microsatellite markers
    • Alcaide M, Negro JJ, Serrano D, Tella JL, Rodríguez C (2005) Extra-pair paternity in the lesser kestrel Falco naumanni: a re-evaluation using microsatellite markers. Ibis, 147, 608 611.
    • (2005) Ibis , vol.147 , pp. 608-611
    • Alcaide, M.1    Negro, J.J.2    Serrano, D.3    Tella, J.L.4    Rodríguez, C.5
  • 4
    • 36149000117 scopus 로고    scopus 로고
    • Characterization, polymorphism and evolution of MHC class II B genes in birds of prey
    • Alcaide M, Edwards SV, Negro JJ (2007) Characterization, polymorphism and evolution of MHC class II B genes in birds of prey. Journal of Molecular Evolution, 65, 541 554.
    • (2007) Journal of Molecular Evolution , vol.65 , pp. 541-554
    • Alcaide, M.1    Edwards, S.V.2    Negro, J.J.3
  • 5
    • 0042208362 scopus 로고    scopus 로고
    • Effect of recombination on the accuracy of the likelihood method for detecting positive selection at amino acid sites
    • Anisimova M, Nielsen R, Yang Z (2003) Effect of recombination on the accuracy of the likelihood method for detecting positive selection at amino acid sites. Genetics, 164, 1229 1236.
    • (2003) Genetics , vol.164 , pp. 1229-1236
    • Anisimova, M.1    Nielsen, R.2    Yang, Z.3
  • 6
    • 0036381627 scopus 로고    scopus 로고
    • Resistance to three pathogens in the endangered winter-run Chinook salmon (Oncorhynchus tshawytscha): Effects of inbreeding and major histocompatibility complex genotypes
    • Arkush KD, Giese AR, Mendonca HL, McBride AM, Marty GD, Hedrick PW (2002) Resistance to three pathogens in the endangered winter-run Chinook salmon (Oncorhynchus tshawytscha): effects of inbreeding and major histocompatibility complex genotypes. Canadian Journal of Fisheries Aquatic Sciences, 59, 966 975.
    • (2002) Canadian Journal of Fisheries Aquatic Sciences , vol.59 , pp. 966-975
    • Arkush, K.D.1    Giese, A.R.2    Mendonca, H.L.3    McBride, A.M.4    Marty, G.D.5    Hedrick, P.W.6
  • 8
    • 0037884727 scopus 로고    scopus 로고
    • MHC studies in nonmodel vertebrates: What have we learned about natural selection in 15 years?
    • Bernatchez L, Landry C (2003) MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? Journal of Evolutionary Biology, 16, 363 377.
    • (2003) Journal of Evolutionary Biology , vol.16 , pp. 363-377
    • Bernatchez, L.1    Landry, C.2
  • 10
    • 0028826394 scopus 로고
    • Host movement and the genetic structure of populations of parasitic nematodes
    • Blouin MS, Yowell CA, Courtney CH, Dame JB (1995) Host movement and the genetic structure of populations of parasitic nematodes. Genetics, 141, 1007 1014.
    • (1995) Genetics , vol.141 , pp. 1007-1014
    • Blouin, M.S.1    Yowell, C.A.2    Courtney, C.H.3    Dame, J.B.4
  • 11
    • 34249781728 scopus 로고    scopus 로고
    • Low MHC variation in the endangered Galapagos penguin (Spheniscus mendiculus
    • Bollmer J, Hernán Vargas F, Parker PG (2007) Low MHC variation in the endangered Galapagos penguin (Spheniscus mendiculus). Immunogenetics, 59, 593 602.
    • (2007) Immunogenetics , vol.59 , pp. 593-602
    • Bollmer, J.1    Hernán Vargas, F.2    Parker, P.G.3
  • 12
    • 33646831806 scopus 로고    scopus 로고
    • MHC alleles associated with local resistance to malaria in a passerine
    • Bonneaud C, Pérez-Tris J, Federici P, Chastel O, Sorci G (2006) MHC alleles associated with local resistance to malaria in a passerine. Evolution, 60, 383 389.
    • (2006) Evolution , vol.60 , pp. 383-389
    • Bonneaud, C.1    Pérez-Tris, J.2    Federici, P.3    Chastel, O.4    Sorci, G.5
  • 14
    • 27744574721 scopus 로고    scopus 로고
    • Molecular characterization of major histocompatibility complex class II alleles in wild tiger salamanders (Ambystoma tigrinum
    • Bos DH, DeWoody JA (2005) Molecular characterization of major histocompatibility complex class II alleles in wild tiger salamanders (Ambystoma tigrinum). Immunogenetics, 57, 775 781.
    • (2005) Immunogenetics , vol.57 , pp. 775-781
    • Bos, D.H.1    Dewoody, J.A.2
  • 15
    • 0031135337 scopus 로고    scopus 로고
    • Recombinant DNA sequences generated by PCR amplification
    • Bradley RD, Hillis DM (1996) Recombinant DNA sequences generated by PCR amplification. Molecular Biology and Evolution, 14, 592 593.
    • (1996) Molecular Biology and Evolution , vol.14 , pp. 592-593
    • Bradley, R.D.1    Hillis, D.M.2
  • 16
    • 0031901554 scopus 로고    scopus 로고
    • Measures of divergence between populaions and the effect of forces that reduce variability
    • Charlesworth B (1998) Measures of divergence between populaions and the effect of forces that reduce variability. Molecular Biology and Evolution, 15, 538 554.
    • (1998) Molecular Biology and Evolution , vol.15 , pp. 538-554
    • Charlesworth, B.1
  • 17
    • 0014029675 scopus 로고
    • Maintenance of histocompatibility polymorphisms
    • Clarke B, Kirby DR (1966) Maintenance of histocompatibility polymorphisms. Nature, 222, 999 1000.
    • (1966) Nature , vol.222 , pp. 999-1000
    • Clarke, B.1    Kirby, D.R.2
  • 18
    • 0037974275 scopus 로고    scopus 로고
    • Microsatellite measures of inbreeding: A meta-analysis
    • Coltman DW, Slate J (2003) Microsatellite measures of inbreeding: a meta-analysis. Evolution, 57, 971 983.
    • (2003) Evolution , vol.57 , pp. 971-983
    • Coltman, D.W.1    Slate, J.2
  • 21
    • 33847071935 scopus 로고    scopus 로고
    • Parasite phylogeograhical congruence with salmon host evolutionary significant unit: Implications for salmon conservation
    • Criscione CD, Blouin MS (2007) Parasite phylogeograhical congruence with salmon host evolutionary significant unit: implications for salmon conservation. Molecular Ecology, 16, 993 1005.
    • (2007) Molecular Ecology , vol.16 , pp. 993-1005
    • Criscione, C.D.1    Blouin, M.S.2
  • 22
    • 13844312671 scopus 로고    scopus 로고
    • On the estimation of genome-wide heterozygosity using molecular markers
    • DeWoody YD, DeWoody JA (2005) On the estimation of genome-wide heterozygosity using molecular markers. Journal of Heredity, 96, 85 88.
    • (2005) Journal of Heredity , vol.96 , pp. 85-88
    • Dewoody, Y.D.1    Dewoody, J.A.2
  • 23
    • 14044274918 scopus 로고    scopus 로고
    • Hitchhiking and recombination in birds: Evidence from MHC-linked and unlinked loci in red-winged blackbirds (Agelaius phoeniceus
    • Edwards SV, Dillon M (2004) Hitchhiking and recombination in birds: evidence from MHC-linked and unlinked loci in red-winged blackbirds (Agelaius phoeniceus). Genetical Research, 84, 175 192.
    • (2004) Genetical Research , vol.84 , pp. 175-192
    • Edwards, S.V.1    Dillon, M.2
  • 24
    • 0031851808 scopus 로고    scopus 로고
    • Evolution and ecology of MHC molecules: From genomics to sexual selection
    • Edwards SV, Hedrick PW (1998) Evolution and ecology of MHC molecules: from genomics to sexual selection. Trends in Ecology & Evolution, 13, 305 311.
    • (1998) Trends in Ecology & Evolution , vol.13 , pp. 305-311
    • Edwards, S.V.1    Hedrick, P.W.2
  • 25
    • 0029583058 scopus 로고
    • Dynamics of MHC evolution in birds and crocodilians: Amplification of class II genes with degenerate primers
    • Edwards SV, Grahn M, Potts WK (1995) Dynamics of MHC evolution in birds and crocodilians: amplification of class II genes with degenerate primers. Molecular Ecology, 4, 719 729.
    • (1995) Molecular Ecology , vol.4 , pp. 719-729
    • Edwards, S.V.1    Grahn, M.2    Potts, W.K.3
  • 26
    • 0031938882 scopus 로고    scopus 로고
    • Genomics and polymophism of Agph-DAB1, an MHC class II B gene in red-winged blackbirds (Agelaius phoenicus)
    • Edwards SV, Gasper J, Stone M (1998) Genomics and polymophism of Agph-DAB1, an MHC class II B gene in red-winged blackbirds (Agelaius phoenicus) Molecular Biology and Evolution, 15, 236 250.
    • (1998) Molecular Biology and Evolution , vol.15 , pp. 236-250
    • Edwards, S.V.1    Gasper, J.2    Stone, M.3
  • 27
    • 33947503411 scopus 로고    scopus 로고
    • Spatial patterns of MHC class II variation in the great snipe (Gallinago media
    • Ekblom R, Jacobson P et al 2007) Spatial patterns of MHC class II variation in the great snipe (Gallinago media). Molecular Ecology, 16, 1439 1451.
    • (2007) Molecular Ecology , vol.16 , pp. 1439-1451
    • Ekblom, R.1    Jacobson, P.2    Al, E.3
  • 29
    • 21244497348 scopus 로고    scopus 로고
    • Microsatellite analyses reveal fine-scale genetic structure in grey mouse lemurs (Microcebus murinus
    • Fredsted T, Pertoldi C, Schierup MH, Kappeler PM (2005) Microsatellite analyses reveal fine-scale genetic structure in grey mouse lemurs (Microcebus murinus). Molecular Ecology, 14, 2363 2372.
    • (2005) Molecular Ecology , vol.14 , pp. 2363-2372
    • Fredsted, T.1    Pertoldi, C.2    Schierup, M.H.3    Kappeler, P.M.4
  • 30
    • 17744386541 scopus 로고    scopus 로고
    • MHC class II DRB constitution and parasite load in the striped mouse Rhabdomys pumilio, in the Southern Kalahari
    • Froeschke G, Sommer S (2005) MHC class II DRB constitution and parasite load in the striped mouse Rhabdomys pumilio, in the Southern Kalahari. Molecular Biology and Evolution, 22, 1254 1259.
    • (2005) Molecular Biology and Evolution , vol.22 , pp. 1254-1259
    • Froeschke, G.1    Sommer, S.2
  • 31
    • 0042785584 scopus 로고    scopus 로고
    • Detecting adaptive molecular polymorphism: Lessons from the MHC
    • Garrigan D, Hedrick PW (2003) Detecting adaptive molecular polymorphism: lessons from the MHC. Evolution, 57, 1707 1722.
    • (2003) Evolution , vol.57 , pp. 1707-1722
    • Garrigan, D.1    Hedrick, P.W.2
  • 32
    • 0034975916 scopus 로고    scopus 로고
    • Songbird genomics: Analysis of 45 kb upstream of a polymorphic MHC class II gene in red-winged blackbirds (Agelaius phoeniceus
    • Gasper JS, Shiina T, Inoko H, Edwards SV (2001) Songbird genomics: analysis of 45 kb upstream of a polymorphic MHC class II gene in red-winged blackbirds (Agelaius phoeniceus). Genomics, 75, 26 34.
    • (2001) Genomics , vol.75 , pp. 26-34
    • Gasper, J.S.1    Shiina, T.2    Inoko, H.3    Edwards, S.V.4
  • 33
    • 0030238017 scopus 로고    scopus 로고
    • An efficient method for the extraction of DNA from vertebrate tissues
    • Gemmell NJ, Akiyama S (1996) An efficient method for the extraction of DNA from vertebrate tissues. Trends in Genetics, 12, 338 339.
    • (1996) Trends in Genetics , vol.12 , pp. 338-339
    • Gemmell, N.J.1    Akiyama, S.2
  • 34
    • 0942289680 scopus 로고    scopus 로고
    • Phylogeraphy, genetic structure and diversity in the bearded vulture (Gypaetus barbatus, L.), as revealed by mitochondrial DNA
    • Godoy JA, Negro JJ, Hiraldo F, Donazar JA (2004) Phylogeraphy, genetic structure and diversity in the bearded vulture (Gypaetus barbatus, L.), as revealed by mitochondrial DNA. Molecular Ecology, 13, 371 390.
    • (2004) Molecular Ecology , vol.13 , pp. 371-390
    • Godoy, J.A.1    Negro, J.J.2    Hiraldo, F.3    Donazar, J.A.4
  • 35
    • 0002051540 scopus 로고    scopus 로고
    • Bioedit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT
    • Hall TA (1999) bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95 98.
    • (1999) Nucleic Acids Symposium Series , vol.41 , pp. 95-98
    • Hall, T.A.1
  • 36
    • 0032460669 scopus 로고    scopus 로고
    • Balancing selection and MHC
    • Hedrick PW (1999) Balancing selection and MHC. Genetica, 104, 207 214.
    • (1999) Genetica , vol.104 , pp. 207-214
    • Hedrick, P.W.1
  • 37
    • 0036807185 scopus 로고    scopus 로고
    • Pathogen resistance and genetic variation at MHC loci
    • Hedrick PW (2002) Pathogen resistance and genetic variation at MHC loci. Evolution, 56, 1902 1908.
    • (2002) Evolution , vol.56 , pp. 1902-1908
    • Hedrick, P.W.1
  • 38
    • 0000307241 scopus 로고    scopus 로고
    • Parasite resistance and genetic variation in the endangered Gila topminow
    • Hedrick PW, Kim TJ, Parker KM (2001) Parasite resistance and genetic variation in the endangered Gila topminow. Animal Conservation, 4, 103 109.
    • (2001) Animal Conservation , vol.4 , pp. 103-109
    • Hedrick, P.W.1    Kim, T.J.2    Parker, K.M.3
  • 39
    • 0034126368 scopus 로고    scopus 로고
    • MHC class II pseudogene and genomic signature of a 32-kb cosmid in the house finch (Carpodacus mexicanus)
    • Hess CM, Gasper J, Hoekstra HE, Hill CE, Edwards SV (2000) MHC class II pseudogene and genomic signature of a 32-kb cosmid in the house finch (Carpodacus mexicanus). Genome Research, 10, 613 623.
    • (2000) Genome Research , vol.10 , pp. 613-623
    • Hess, C.M.1    Gasper, J.2    Hoekstra, H.E.3    Hill, C.E.4    Edwards, S.V.5
  • 40
    • 0001134081 scopus 로고
    • HLA association with malaria in Africa: Some implications for MHC evolution
    • In: (eds. Klein, J., Klein, D. pp. Springer, Berlin and Heidelberg.
    • Hill AVS (1991) HLA association with malaria in Africa: some implications for MHC evolution. In : Molecular Evolution of the Major Histcompatibility Complex (eds Klein J, Klein D pp. 403 419. Springer, Berlin and Heidelberg.
    • (1991) Molecular Evolution of the Major Histcompatibility Complex , pp. 403-419
    • Hill, A.V.S.1
  • 41
    • 0031918872 scopus 로고    scopus 로고
    • The immunogenetics of human infectious diseases
    • Hill AVS (1998) The immunogenetics of human infectious diseases. Annual Reviews of Immunology, 16, 593 617.
    • (1998) Annual Reviews of Immunology , vol.16 , pp. 593-617
    • Hill, A.V.S.1
  • 42
    • 0026709389 scopus 로고
    • Estimation of levels of gene flow from DNA sequence data
    • Hudson RR, Slatkin M, Maddison WP (1992) Estimation of levels of gene flow from DNA sequence data. Genetics, 132, 583 589.
    • (1992) Genetics , vol.132 , pp. 583-589
    • Hudson, R.R.1    Slatkin, M.2    Maddison, W.P.3
  • 43
    • 84985801111 scopus 로고
    • MHC polymorphism and the design of captive breeding programs
    • Hughes AL (1991) MHC polymorphism and the design of captive breeding programs. Conservation Biology, 5, 249 251.
    • (1991) Conservation Biology , vol.5 , pp. 249-251
    • Hughes, A.L.1
  • 44
    • 0026575161 scopus 로고
    • Maintenance of MHC polymorphism
    • Hughes AL, Nei M (1992) Maintenance of MHC polymorphism. Nature, 355, 402 403.
    • (1992) Nature , vol.355 , pp. 402-403
    • Hughes, A.L.1    Nei, M.2
  • 45
    • 30744470609 scopus 로고    scopus 로고
    • Application of phylogenetic networks in evolutionary studies
    • Huson H, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution, 23, 254 267.
    • (2006) Molecular Biology and Evolution , vol.23 , pp. 254-267
    • Huson, H.1    Bryant, D.2
  • 46
    • 0034013492 scopus 로고    scopus 로고
    • The major and a minor class II beta-chain (B-LB) gene flank the Tapasin gene in the B-F/B-L region of the chicken major histocompatibility complex
    • Jacob JP, Milne S, Beck S, Kaufman J (2000) The major and a minor class II beta-chain (B-LB) gene flank the Tapasin gene in the B-F/B-L region of the chicken major histocompatibility complex. Immunogenetics, 51, 138 147.
    • (2000) Immunogenetics , vol.51 , pp. 138-147
    • Jacob, J.P.1    Milne, S.2    Beck, S.3    Kaufman, J.4
  • 47
    • 3242671787 scopus 로고    scopus 로고
    • Natural selection of the major histocompatibility complex (MHC) in Hawaiian honeycreepers (Drepanidinae
    • Jarvi SI, Tarr CL, McIntosh CE, Atkinson CT, Fleischer RC (2004) Natural selection of the major histocompatibility complex (MHC) in Hawaiian honeycreepers (Drepanidinae). Molecular Ecology, 13, 2157 2168.
    • (2004) Molecular Ecology , vol.13 , pp. 2157-2168
    • Jarvi, S.I.1    Tarr, C.L.2    McIntosh, C.E.3    Atkinson, C.T.4    Fleischer, R.C.5
  • 48
    • 0030781241 scopus 로고    scopus 로고
    • The 'minimal essential MHC' revisited: Both peptide-binding and cell surface expression level of MHC molecules are polymorphisms selected by pathogens in chickens
    • Kaufman J, Salomonsen J (1997) The 'minimal essential MHC' revisited: both peptide-binding and cell surface expression level of MHC molecules are polymorphisms selected by pathogens in chickens. Hereditas, 127, 67 73.
    • (1997) Hereditas , vol.127 , pp. 67-73
    • Kaufman, J.1    Salomonsen, J.2
  • 50
    • 0025276271 scopus 로고
    • Nomenclature for the major histocompatibility complexes of different species: A proposal
    • Klein J, Bontrop RE, Dawkins RL et al. (1990) Nomenclature for the major histocompatibility complexes of different species: a proposal. Immunogenetics, 31, 217 219.
    • (1990) Immunogenetics , vol.31 , pp. 217-219
    • Klein, J.1    Bontrop, R.E.2    Dawkins, R.L.3
  • 52
    • 3242730562 scopus 로고    scopus 로고
    • Population genetics after fragmentation: The case of the endangered Spanish imperial eagle (Aquila adalberti
    • Martínez-Cruz B, Godoy JA, Negro JJ (2004) Population genetics after fragmentation: the case of the endangered Spanish imperial eagle (Aquila adalberti). Molecular Ecology, 13, 2243 2255.
    • (2004) Molecular Ecology , vol.13 , pp. 2243-2255
    • Martínez-Cruz, B.1    Godoy, J.A.2    Negro, J.J.3
  • 53
    • 24944536197 scopus 로고    scopus 로고
    • Comparative host-parsite population structures: Disentangling prospecting and dispersal in the black-legged kittiwake Rissa tridactyla
    • McCoy KD, Boulinier T, Tirard C (2005) Comparative host-parsite population structures: disentangling prospecting and dispersal in the black-legged kittiwake Rissa tridactyla. Molecular Ecology, 14, 2825 2838.
    • (2005) Molecular Ecology , vol.14 , pp. 2825-2838
    • McCoy, K.D.1    Boulinier, T.2    Tirard, C.3
  • 54
    • 29144440320 scopus 로고    scopus 로고
    • Characterization of MHC class II genes from an ancient reptile lineage, Sphenodon (tuatara)
    • Miller HC, Belov K, Daugherty CH (2005) Characterization of MHC class II genes from an ancient reptile lineage, Sphenodon (tuatara). Immunogenetics, 57, 883 891.
    • (2005) Immunogenetics , vol.57 , pp. 883-891
    • Miller, H.C.1    Belov, K.2    Daugherty, C.H.3
  • 55
    • 0035544477 scopus 로고    scopus 로고
    • Geographic heterogeneity in natural selection on an MHC locus in sockeye salmon
    • Miller KM, Kaukinen KH, Beacham TD, Withler RE (2001) Geographic heterogeneity in natural selection on an MHC locus in sockeye salmon. Genetica, 111, 237 257.
    • (2001) Genetica , vol.111 , pp. 237-257
    • Miller, K.M.1    Kaukinen, K.H.2    Beacham, T.D.3    Withler, R.E.4
  • 56
    • 9644255666 scopus 로고    scopus 로고
    • Genetic drift outweighs balancing selection in shaping post-bottleneck major histocompatibility complex variation in New Zealand robins (Petroicidae)
    • Miller HC, Lambert DM (2004a) Genetic drift outweighs balancing selection in shaping post-bottleneck major histocompatibility complex variation in New Zealand robins (Petroicidae). Molecular Ecology, 13, 3709 3721.
    • (2004) Molecular Ecology , vol.13 , pp. 3709-3721
    • Miller, H.C.1    Lambert, D.M.2
  • 57
    • 3142731513 scopus 로고    scopus 로고
    • Gene duplication and gene conversion in class II MHC genes of New Zealand robins (Petroicidae
    • Miller HC, Lambert DM (2004b) Gene duplication and gene conversion in class II MHC genes of New Zealand robins (Petroicidae). Immunogenetics, 56, 178 191.
    • (2004) Immunogenetics , vol.56 , pp. 178-191
    • Miller, H.C.1    Lambert, D.M.2
  • 58
    • 0030829222 scopus 로고    scopus 로고
    • MHC diversity in Pacific salmon: Population structure and trans-species allelism
    • Miller KM, Whitler RE (1997) MHC diversity in Pacific salmon: population structure and trans-species allelism. Hereditas, 127, 83 95.
    • (1997) Hereditas , vol.127 , pp. 83-95
    • Miller, K.M.1    Whitler, R.E.2
  • 59
    • 0031260370 scopus 로고    scopus 로고
    • Population differentiation at MHC genes in chinook salmon Oncorhynchus tshawytscha
    • Miller KM, Whitler RE, Beacham TD (1997) Population differentiation at MHC genes in chinook salmon Oncorhynchus tshawytscha. Molecular Ecology, 6, 937 954.
    • (1997) Molecular Ecology , vol.6 , pp. 937-954
    • Miller, K.M.1    Whitler, R.E.2    Beacham, T.D.3
  • 60
    • 5344277488 scopus 로고    scopus 로고
    • Evolution of MHC-DRB class II polymorphism in the genus Apodemus and a comparison of DRB sequences within the family Muridae (Mammalia: Rodentia
    • Musolf K, Meyer-Lucht Y, Sommer S (2004) Evolution of MHC-DRB class II polymorphism in the genus Apodemus and a comparison of DRB sequences within the family Muridae (Mammalia: Rodentia). Immunogenetics, 56, 420 426.
    • (2004) Immunogenetics , vol.56 , pp. 420-426
    • Musolf, K.1    Meyer-Lucht, Y.2    Sommer, S.3
  • 61
    • 0030867404 scopus 로고    scopus 로고
    • Causes of natal dispersal in the lesser kestrel: Inbreeding avoidance or resource competition?
    • Negro JJ, Hiraldo F, Donazar JA (1997) Causes of natal dispersal in the lesser kestrel: inbreeding avoidance or resource competition? Journal of Animal Ecology, 66, 640 648.
    • (1997) Journal of Animal Ecology , vol.66 , pp. 640-648
    • Negro, J.J.1    Hiraldo, F.2    Donazar, J.A.3
  • 62
    • 0033994645 scopus 로고    scopus 로고
    • Genetic relationship in the peregrine falcon (Falco peregrinus) analysed by microsatellite DNA markers
    • Nesje M, Roed KH, Lifjeld JT, Lindberg P, Steens OF (2000) Genetic relationship in the peregrine falcon (Falco peregrinus) analysed by microsatellite DNA markers. Molecular Ecology, 9, 53 60.
    • (2000) Molecular Ecology , vol.9 , pp. 53-60
    • Nesje, M.1    Roed, K.H.2    Lifjeld, J.T.3    Lindberg, P.4    Steens, O.F.5
  • 63
    • 33947498160 scopus 로고    scopus 로고
    • Phylogeography and population structure of the saker falcon (Falco cherrug) and the influence of hybridization: Mitochondrial and microsatellite data
    • Nittinger F, Gamauf A, Pinsker W, Wink M, Haring E (2007) Phylogeography and population structure of the saker falcon (Falco cherrug) and the influence of hybridization: mitochondrial and microsatellite data. Molecular Ecology, 16, 1497 1151.
    • (2007) Molecular Ecology , vol.16 , pp. 1497-1151
    • Nittinger, F.1    Gamauf, A.2    Pinsker, W.3    Wink, M.4    Haring, E.5
  • 64
    • 0029310503 scopus 로고
    • Microsatellite analysis of population structure in Canadian polar bears
    • Paetkau D, Calvert W, Stirling I, Strobeck C (1995) Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology, 4, 347 354.
    • (1995) Molecular Ecology , vol.4 , pp. 347-354
    • Paetkau, D.1    Calvert, W.2    Stirling, I.3    Strobeck, C.4
  • 65
    • 0037143716 scopus 로고    scopus 로고
    • MHC heterozygosity confers a selective advantage against multiple-strain infections
    • Penn DJ, Damjanovich K, Potts WK (2002) MHC heterozygosity confers a selective advantage against multiple-strain infections. PNAS, 99, 11260 11264.
    • (2002) PNAS , vol.99 , pp. 11260-11264
    • Penn, D.J.1    Damjanovich, K.2    Potts, W.K.3
  • 66
    • 0033036460 scopus 로고    scopus 로고
    • The evolution of mating preferences and major histocompatibility genes
    • Penn DJ, Potts WK (1999) The evolution of mating preferences and major histocompatibility genes. American Naturalist, 153, 145 164.
    • (1999) American Naturalist , vol.153 , pp. 145-164
    • Penn, D.J.1    Potts, W.K.2
  • 67
    • 1042267712 scopus 로고    scopus 로고
    • Major histocompatibility complex B-LB gene variation in red grouse, Lagopus lagopus scoticus.
    • Piertney SB (2003) Major histocompatibility complex B-LB gene variation in red grouse, Lagopus lagopus scoticus. Wildlife Biology, 9, 251 259.
    • (2003) Wildlife Biology , vol.9 , pp. 251-259
    • Piertney, S.B.1
  • 68
    • 33644998297 scopus 로고    scopus 로고
    • The evolutionary ecology of the major histocompatibility complex
    • Piertney SB, Oliver MK (2006) The evolutionary ecology of the major histocompatibility complex. Heredity, 96, 7 21.
    • (2006) Heredity , vol.96 , pp. 7-21
    • Piertney, S.B.1    Oliver, M.K.2
  • 69
    • 0000262278 scopus 로고
    • Genepop (version 1.2): Population genetics software for exact tests and ecumenicism
    • Raymond M, Rousset F (1995) genepop (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248 249.
    • (1995) Journal of Heredity , vol.86 , pp. 248-249
    • Raymond, M.1    Rousset, F.2
  • 70
    • 0038725529 scopus 로고    scopus 로고
    • Relative roles of mutation and recombination in generating allelic polymorphism at MHC class II locus in Peromyscus maniculatus
    • Richman A, Herrera LG, Nash D, Schierup MH (2003) Relative roles of mutation and recombination in generating allelic polymorphism at MHC class II locus in Peromyscus maniculatus. Genetical Research, 82, 89 99.
    • (2003) Genetical Research , vol.82 , pp. 89-99
    • Richman, A.1    Herrera, L.G.2    Nash, D.3    Schierup, M.H.4
  • 71
    • 0034096818 scopus 로고    scopus 로고
    • IMGT/HLA database - A sequence database for the human major histocompatibility complex
    • Robinson J, Malik A, Parham P, Bodmer JG, Marsh SGE (2000) IMGT/HLA database - a sequence database for the human major histocompatibility complex. Tissue Antigens, 55, 280 287.
    • (2000) Tissue Antigens , vol.55 , pp. 280-287
    • Robinson, J.1    Malik, A.2    Parham, P.3    Bodmer, J.G.4    Marsh, S.G.E.5
  • 72
  • 73
    • 0037656158 scopus 로고    scopus 로고
    • Dispersal within a spatially structured population of lesser kestrel: The role of spatial isolation and conspecific attraction
    • Serrano D, Tella JL (2003) Dispersal within a spatially structured population of lesser kestrel: the role of spatial isolation and conspecific attraction. Journal of Animal Ecology, 72, 400 410.
    • (2003) Journal of Animal Ecology , vol.72 , pp. 400-410
    • Serrano, D.1    Tella, J.L.2
  • 74
    • 0034925069 scopus 로고    scopus 로고
    • Factors affecting breeding dispersal in the facultatively colonial Lesser kestrel: Individual experience vs conspecific cues
    • Serrano D, Tella JL, Forero MG, Donázar JA (2001) Factors affecting breeding dispersal in the facultatively colonial Lesser kestrel: individual experience vs conspecific cues. Journal of Animal Ecology, 70, 568 578.
    • (2001) Journal of Animal Ecology , vol.70 , pp. 568-578
    • Serrano, D.1    Tella, J.L.2    Forero, M.G.3    Donázar, J.A.4
  • 75
    • 27744606052 scopus 로고    scopus 로고
    • The importance of immune gene variability in evolutionary ecology and evolution
    • Sommer S (2005) The importance of immune gene variability in evolutionary ecology and evolution. Frontiers in Zoology, 2, 16.
    • (2005) Frontiers in Zoology , vol.2 , pp. 16
    • Sommer, S.1
  • 76
    • 0031861299 scopus 로고    scopus 로고
    • Conflicts between lesser kestrel conservation and European agricultural policies identified by habitat use analyses
    • Tella JL, Forero MG, Hiraldo F, Donázar JA (1998) Conflicts between lesser kestrel conservation and European agricultural policies identified by habitat use analyses. Conservation Biology, 12, 593 604.
    • (1998) Conservation Biology , vol.12 , pp. 593-604
    • Tella, J.L.1    Forero, M.G.2    Hiraldo, F.3    Donázar, J.A.4
  • 78
    • 0038379170 scopus 로고    scopus 로고
    • Advantage of rare HLA supertype in HIV disease progression
    • Trachtenberg E, Korber B, Sollars C et al 2003) Advantage of rare HLA supertype in HIV disease progression. Nature Medicine, 9, 928 935.
    • (2003) Nature Medicine , vol.9 , pp. 928-935
    • Trachtenberg, E.1    Korber, B.2    Sollars, C.3    Al, E.4
  • 79
    • 12044254346 scopus 로고
    • Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift
    • Wagner A, Blackstone N, Cartwright P et al 1994) Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift. Systematic Biology, 43, 250 261.
    • (1994) Systematic Biology , vol.43 , pp. 250-261
    • Wagner, A.1    Blackstone, N.2    Cartwright, P.3    Al, E.4
  • 80
    • 33645016750 scopus 로고    scopus 로고
    • Genetic variation in MHC class II expression and interactions with MHC sequence polymorphism in three-spined sticklebacks
    • Wegner KM, Kalbe M, Rauch G, Kurtz J, Schaschl H, Reusch TBH (2006) Genetic variation in MHC class II expression and interactions with MHC sequence polymorphism in three-spined sticklebacks. Molecular Ecology, 15, 1153 1164.
    • (2006) Molecular Ecology , vol.15 , pp. 1153-1164
    • Wegner, K.M.1    Kalbe, M.2    Rauch, G.3    Kurtz, J.4    Schaschl, H.5    Reusch, T.B.H.6
  • 81
    • 3042698704 scopus 로고    scopus 로고
    • MHC class I typing in a songbird with numerous loci and high polymorphism using motif-specific PCR and DGGE
    • Westerdahl H, Wittzell H, von Schantz T, Bensch S (2004) MHC class I typing in a songbird with numerous loci and high polymorphism using motif-specific PCR and DGGE. Heredity, 92, 534 542.
    • (2004) Heredity , vol.92 , pp. 534-542
    • Westerdahl, H.1    Wittzell, H.2    Von Schantz, T.3    Bensch, S.4
  • 82
    • 33645229840 scopus 로고    scopus 로고
    • Estimating diversifying selection and functional constraint in the presence of recombination
    • Wilson DJ, McVean G (2006) Estimating diversifying selection and functional constraint in the presence of recombination. Genetics, 172, 1411 1425.
    • (2006) Genetics , vol.172 , pp. 1411-1425
    • Wilson, D.J.1    McVean, G.2
  • 84
    • 0032933802 scopus 로고    scopus 로고
    • Concerted evolution of two MHC class II B loci in pheasants and domestic chickens
    • Witzell H, Bernot A, Auffrey C, Zoorob R (1999) Concerted evolution of two MHC class II B loci in pheasants and domestic chickens. Molecular Biology and Evolution, 16, 479 490.
    • (1999) Molecular Biology and Evolution , vol.16 , pp. 479-490
    • Witzell, H.1    Bernot, A.2    Auffrey, C.3    Zoorob, R.4
  • 85
  • 86
    • 0032605010 scopus 로고    scopus 로고
    • Analysis of genetic polymorphism in the major histocompatibility complex of Japanese quail
    • Ye X, Zhu J, Velleman SG, Bacon WL, Nestor KE (1999) Analysis of genetic polymorphism in the major histocompatibility complex of Japanese quail. Poultry Science, 78, 8 14.
    • (1999) Poultry Science , vol.78 , pp. 8-14
    • Ye, X.1    Zhu, J.2    Velleman, S.G.3    Bacon, W.L.4    Nestor, K.E.5
  • 87
    • 0025210143 scopus 로고
    • Organization of a functional chicken class II B gene
    • Miguel Alcaide is interested in the investigation of adaptive genetic variation in vertebrates. Scott Edwards and his lab are interested in the population genetics, comparative genomics and evolution of birds and relatives. Juan José Negro although initially trained as a behavioural ecologist, is also interested in genetic variability issues, hybridization and genetic erosion in small populations. David Serrano is interested in behavioural ecology, demography and population ecology. His main research lines focus of animal dispersal and evolution of avian coloniality. José L. Tella is interested in a variety of evolutionary, behavioural and conservation ecology issues, including the demographic, genetic, physiological and cultural effects of habitat fragmentation on bird populations. Primer sequences for locus Cl347 (F: TGTGTGTGTAAGGTTGCCAAA; R: CGTTCTCAACATGCCAGTTT) and Cl58 (F: TGTGTCTCAGTGGGGAAAAA; R: TGCTTTGGTGCTGAAGAAAC).
    • Zoorob R, Behar G, Kroemer G, Auffrey C (1990) Organization of a functional chicken class II B gene. Immunogenetics, 31, 179 187.
    • (1990) Immunogenetics , vol.31 , pp. 179-187
    • Zoorob, R.1    Behar, G.2    Kroemer, G.3    Auffrey, C.4


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.