-
1
-
-
1542723469
-
High MHC diversity maintained by balancing selection in an otherwise genetically monomorphic mammal
-
Aguilar A, Roemer G, Debenham S, Binns M, Garcelon D, Wayne RK (2004) High MHC diversity maintained by balancing selection in an otherwise genetically monomorphic mammal. Proceedings of the National Academy of Sciences, USA, 101, 3490 3494.
-
(2004)
Proceedings of the National Academy of Sciences, USA
, vol.101
, pp. 3490-3494
-
-
Aguilar, A.1
Roemer, G.2
Debenham, S.3
Binns, M.4
Garcelon, D.5
Wayne, R.K.6
-
2
-
-
33644884224
-
Patterns of variation in MHC class II B loci of the little greenbul (Andropadus virens) with comments on MHC evolution in birds
-
Aguilar A, Edwards SV, Smith TB, Wayne RK (2006) Patterns of variation in MHC class II B loci of the little greenbul (Andropadus virens) with comments on MHC evolution in birds. Journal of Heredity, 97, 133 142.
-
(2006)
Journal of Heredity
, vol.97
, pp. 133-142
-
-
Aguilar, A.1
Edwards, S.V.2
Smith, T.B.3
Wayne, R.K.4
-
3
-
-
22744453199
-
Extra-pair paternity in the lesser kestrel Falco naumanni: A re-evaluation using microsatellite markers
-
Alcaide M, Negro JJ, Serrano D, Tella JL, Rodríguez C (2005) Extra-pair paternity in the lesser kestrel Falco naumanni: a re-evaluation using microsatellite markers. Ibis, 147, 608 611.
-
(2005)
Ibis
, vol.147
, pp. 608-611
-
-
Alcaide, M.1
Negro, J.J.2
Serrano, D.3
Tella, J.L.4
Rodríguez, C.5
-
4
-
-
36149000117
-
Characterization, polymorphism and evolution of MHC class II B genes in birds of prey
-
Alcaide M, Edwards SV, Negro JJ (2007) Characterization, polymorphism and evolution of MHC class II B genes in birds of prey. Journal of Molecular Evolution, 65, 541 554.
-
(2007)
Journal of Molecular Evolution
, vol.65
, pp. 541-554
-
-
Alcaide, M.1
Edwards, S.V.2
Negro, J.J.3
-
5
-
-
0042208362
-
Effect of recombination on the accuracy of the likelihood method for detecting positive selection at amino acid sites
-
Anisimova M, Nielsen R, Yang Z (2003) Effect of recombination on the accuracy of the likelihood method for detecting positive selection at amino acid sites. Genetics, 164, 1229 1236.
-
(2003)
Genetics
, vol.164
, pp. 1229-1236
-
-
Anisimova, M.1
Nielsen, R.2
Yang, Z.3
-
6
-
-
0036381627
-
Resistance to three pathogens in the endangered winter-run Chinook salmon (Oncorhynchus tshawytscha): Effects of inbreeding and major histocompatibility complex genotypes
-
Arkush KD, Giese AR, Mendonca HL, McBride AM, Marty GD, Hedrick PW (2002) Resistance to three pathogens in the endangered winter-run Chinook salmon (Oncorhynchus tshawytscha): effects of inbreeding and major histocompatibility complex genotypes. Canadian Journal of Fisheries Aquatic Sciences, 59, 966 975.
-
(2002)
Canadian Journal of Fisheries Aquatic Sciences
, vol.59
, pp. 966-975
-
-
Arkush, K.D.1
Giese, A.R.2
Mendonca, H.L.3
McBride, A.M.4
Marty, G.D.5
Hedrick, P.W.6
-
7
-
-
0003576389
-
-
Laboratoire Génome, Populations, Interactions, CNRS UMR 5000, Université de Montpellier II, Montpellier, France.
-
Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (1996-2002) genetix 4.04 Logiciel sous Windows, pour la Génétique des Populaions. Laboratoire Génome, Populations, Interactions, CNRS UMR 5000, Université de Montpellier II, Montpellier, France.
-
(1996)
Genetix 4.04 Logiciel Sous Windows, Pour la Génétique des Populaions.
-
-
Belkhir, K.1
Borsa, P.2
Chikhi, L.3
Raufaste, N.4
Bonhomme, F.5
-
8
-
-
0037884727
-
MHC studies in nonmodel vertebrates: What have we learned about natural selection in 15 years?
-
Bernatchez L, Landry C (2003) MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? Journal of Evolutionary Biology, 16, 363 377.
-
(2003)
Journal of Evolutionary Biology
, vol.16
, pp. 363-377
-
-
Bernatchez, L.1
Landry, C.2
-
10
-
-
0028826394
-
Host movement and the genetic structure of populations of parasitic nematodes
-
Blouin MS, Yowell CA, Courtney CH, Dame JB (1995) Host movement and the genetic structure of populations of parasitic nematodes. Genetics, 141, 1007 1014.
-
(1995)
Genetics
, vol.141
, pp. 1007-1014
-
-
Blouin, M.S.1
Yowell, C.A.2
Courtney, C.H.3
Dame, J.B.4
-
11
-
-
34249781728
-
Low MHC variation in the endangered Galapagos penguin (Spheniscus mendiculus
-
Bollmer J, Hernán Vargas F, Parker PG (2007) Low MHC variation in the endangered Galapagos penguin (Spheniscus mendiculus). Immunogenetics, 59, 593 602.
-
(2007)
Immunogenetics
, vol.59
, pp. 593-602
-
-
Bollmer, J.1
Hernán Vargas, F.2
Parker, P.G.3
-
12
-
-
33646831806
-
MHC alleles associated with local resistance to malaria in a passerine
-
Bonneaud C, Pérez-Tris J, Federici P, Chastel O, Sorci G (2006) MHC alleles associated with local resistance to malaria in a passerine. Evolution, 60, 383 389.
-
(2006)
Evolution
, vol.60
, pp. 383-389
-
-
Bonneaud, C.1
Pérez-Tris, J.2
Federici, P.3
Chastel, O.4
Sorci, G.5
-
13
-
-
2342504658
-
Diversity of MHC class I and IIB genes in house sparrows (Passer domesticus)
-
Bonneaud C, Sorci G, Morin V, Westerdahl H, Zoorob R, Wittzell H (2004) Diversity of MHC class I and IIB genes in house sparrows (Passer domesticus). Immunogenetics, 55, 855 865.
-
(2004)
Immunogenetics
, vol.55
, pp. 855-865
-
-
Bonneaud, C.1
Sorci, G.2
Morin, V.3
Westerdahl, H.4
Zoorob, R.5
Wittzell, H.6
-
14
-
-
27744574721
-
Molecular characterization of major histocompatibility complex class II alleles in wild tiger salamanders (Ambystoma tigrinum
-
Bos DH, DeWoody JA (2005) Molecular characterization of major histocompatibility complex class II alleles in wild tiger salamanders (Ambystoma tigrinum). Immunogenetics, 57, 775 781.
-
(2005)
Immunogenetics
, vol.57
, pp. 775-781
-
-
Bos, D.H.1
Dewoody, J.A.2
-
15
-
-
0031135337
-
Recombinant DNA sequences generated by PCR amplification
-
Bradley RD, Hillis DM (1996) Recombinant DNA sequences generated by PCR amplification. Molecular Biology and Evolution, 14, 592 593.
-
(1996)
Molecular Biology and Evolution
, vol.14
, pp. 592-593
-
-
Bradley, R.D.1
Hillis, D.M.2
-
16
-
-
0031901554
-
Measures of divergence between populaions and the effect of forces that reduce variability
-
Charlesworth B (1998) Measures of divergence between populaions and the effect of forces that reduce variability. Molecular Biology and Evolution, 15, 538 554.
-
(1998)
Molecular Biology and Evolution
, vol.15
, pp. 538-554
-
-
Charlesworth, B.1
-
17
-
-
0014029675
-
Maintenance of histocompatibility polymorphisms
-
Clarke B, Kirby DR (1966) Maintenance of histocompatibility polymorphisms. Nature, 222, 999 1000.
-
(1966)
Nature
, vol.222
, pp. 999-1000
-
-
Clarke, B.1
Kirby, D.R.2
-
18
-
-
0037974275
-
Microsatellite measures of inbreeding: A meta-analysis
-
Coltman DW, Slate J (2003) Microsatellite measures of inbreeding: a meta-analysis. Evolution, 57, 971 983.
-
(2003)
Evolution
, vol.57
, pp. 971-983
-
-
Coltman, D.W.1
Slate, J.2
-
20
-
-
0008252566
-
Considering evolutionary processes in conservation biology
-
Crandall KA, Bininda-Emonds ORP, Mace GM, Wayne RK (2000) Considering evolutionary processes in conservation biology. Trends in Ecology & Evolution, 17, 390 395.
-
(2000)
Trends in Ecology & Evolution
, vol.17
, pp. 390-395
-
-
Crandall, K.A.1
Bininda-Emonds, O.R.P.2
MacE, G.M.3
Wayne, R.K.4
-
21
-
-
33847071935
-
Parasite phylogeograhical congruence with salmon host evolutionary significant unit: Implications for salmon conservation
-
Criscione CD, Blouin MS (2007) Parasite phylogeograhical congruence with salmon host evolutionary significant unit: implications for salmon conservation. Molecular Ecology, 16, 993 1005.
-
(2007)
Molecular Ecology
, vol.16
, pp. 993-1005
-
-
Criscione, C.D.1
Blouin, M.S.2
-
22
-
-
13844312671
-
On the estimation of genome-wide heterozygosity using molecular markers
-
DeWoody YD, DeWoody JA (2005) On the estimation of genome-wide heterozygosity using molecular markers. Journal of Heredity, 96, 85 88.
-
(2005)
Journal of Heredity
, vol.96
, pp. 85-88
-
-
Dewoody, Y.D.1
Dewoody, J.A.2
-
23
-
-
14044274918
-
Hitchhiking and recombination in birds: Evidence from MHC-linked and unlinked loci in red-winged blackbirds (Agelaius phoeniceus
-
Edwards SV, Dillon M (2004) Hitchhiking and recombination in birds: evidence from MHC-linked and unlinked loci in red-winged blackbirds (Agelaius phoeniceus). Genetical Research, 84, 175 192.
-
(2004)
Genetical Research
, vol.84
, pp. 175-192
-
-
Edwards, S.V.1
Dillon, M.2
-
24
-
-
0031851808
-
Evolution and ecology of MHC molecules: From genomics to sexual selection
-
Edwards SV, Hedrick PW (1998) Evolution and ecology of MHC molecules: from genomics to sexual selection. Trends in Ecology & Evolution, 13, 305 311.
-
(1998)
Trends in Ecology & Evolution
, vol.13
, pp. 305-311
-
-
Edwards, S.V.1
Hedrick, P.W.2
-
25
-
-
0029583058
-
Dynamics of MHC evolution in birds and crocodilians: Amplification of class II genes with degenerate primers
-
Edwards SV, Grahn M, Potts WK (1995) Dynamics of MHC evolution in birds and crocodilians: amplification of class II genes with degenerate primers. Molecular Ecology, 4, 719 729.
-
(1995)
Molecular Ecology
, vol.4
, pp. 719-729
-
-
Edwards, S.V.1
Grahn, M.2
Potts, W.K.3
-
26
-
-
0031938882
-
Genomics and polymophism of Agph-DAB1, an MHC class II B gene in red-winged blackbirds (Agelaius phoenicus)
-
Edwards SV, Gasper J, Stone M (1998) Genomics and polymophism of Agph-DAB1, an MHC class II B gene in red-winged blackbirds (Agelaius phoenicus) Molecular Biology and Evolution, 15, 236 250.
-
(1998)
Molecular Biology and Evolution
, vol.15
, pp. 236-250
-
-
Edwards, S.V.1
Gasper, J.2
Stone, M.3
-
27
-
-
33947503411
-
Spatial patterns of MHC class II variation in the great snipe (Gallinago media
-
Ekblom R, Jacobson P et al 2007) Spatial patterns of MHC class II variation in the great snipe (Gallinago media). Molecular Ecology, 16, 1439 1451.
-
(2007)
Molecular Ecology
, vol.16
, pp. 1439-1451
-
-
Ekblom, R.1
Jacobson, P.2
Al, E.3
-
29
-
-
21244497348
-
Microsatellite analyses reveal fine-scale genetic structure in grey mouse lemurs (Microcebus murinus
-
Fredsted T, Pertoldi C, Schierup MH, Kappeler PM (2005) Microsatellite analyses reveal fine-scale genetic structure in grey mouse lemurs (Microcebus murinus). Molecular Ecology, 14, 2363 2372.
-
(2005)
Molecular Ecology
, vol.14
, pp. 2363-2372
-
-
Fredsted, T.1
Pertoldi, C.2
Schierup, M.H.3
Kappeler, P.M.4
-
30
-
-
17744386541
-
MHC class II DRB constitution and parasite load in the striped mouse Rhabdomys pumilio, in the Southern Kalahari
-
Froeschke G, Sommer S (2005) MHC class II DRB constitution and parasite load in the striped mouse Rhabdomys pumilio, in the Southern Kalahari. Molecular Biology and Evolution, 22, 1254 1259.
-
(2005)
Molecular Biology and Evolution
, vol.22
, pp. 1254-1259
-
-
Froeschke, G.1
Sommer, S.2
-
31
-
-
0042785584
-
Detecting adaptive molecular polymorphism: Lessons from the MHC
-
Garrigan D, Hedrick PW (2003) Detecting adaptive molecular polymorphism: lessons from the MHC. Evolution, 57, 1707 1722.
-
(2003)
Evolution
, vol.57
, pp. 1707-1722
-
-
Garrigan, D.1
Hedrick, P.W.2
-
32
-
-
0034975916
-
Songbird genomics: Analysis of 45 kb upstream of a polymorphic MHC class II gene in red-winged blackbirds (Agelaius phoeniceus
-
Gasper JS, Shiina T, Inoko H, Edwards SV (2001) Songbird genomics: analysis of 45 kb upstream of a polymorphic MHC class II gene in red-winged blackbirds (Agelaius phoeniceus). Genomics, 75, 26 34.
-
(2001)
Genomics
, vol.75
, pp. 26-34
-
-
Gasper, J.S.1
Shiina, T.2
Inoko, H.3
Edwards, S.V.4
-
33
-
-
0030238017
-
An efficient method for the extraction of DNA from vertebrate tissues
-
Gemmell NJ, Akiyama S (1996) An efficient method for the extraction of DNA from vertebrate tissues. Trends in Genetics, 12, 338 339.
-
(1996)
Trends in Genetics
, vol.12
, pp. 338-339
-
-
Gemmell, N.J.1
Akiyama, S.2
-
34
-
-
0942289680
-
Phylogeraphy, genetic structure and diversity in the bearded vulture (Gypaetus barbatus, L.), as revealed by mitochondrial DNA
-
Godoy JA, Negro JJ, Hiraldo F, Donazar JA (2004) Phylogeraphy, genetic structure and diversity in the bearded vulture (Gypaetus barbatus, L.), as revealed by mitochondrial DNA. Molecular Ecology, 13, 371 390.
-
(2004)
Molecular Ecology
, vol.13
, pp. 371-390
-
-
Godoy, J.A.1
Negro, J.J.2
Hiraldo, F.3
Donazar, J.A.4
-
35
-
-
0002051540
-
Bioedit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT
-
Hall TA (1999) bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95 98.
-
(1999)
Nucleic Acids Symposium Series
, vol.41
, pp. 95-98
-
-
Hall, T.A.1
-
36
-
-
0032460669
-
Balancing selection and MHC
-
Hedrick PW (1999) Balancing selection and MHC. Genetica, 104, 207 214.
-
(1999)
Genetica
, vol.104
, pp. 207-214
-
-
Hedrick, P.W.1
-
37
-
-
0036807185
-
Pathogen resistance and genetic variation at MHC loci
-
Hedrick PW (2002) Pathogen resistance and genetic variation at MHC loci. Evolution, 56, 1902 1908.
-
(2002)
Evolution
, vol.56
, pp. 1902-1908
-
-
Hedrick, P.W.1
-
38
-
-
0000307241
-
Parasite resistance and genetic variation in the endangered Gila topminow
-
Hedrick PW, Kim TJ, Parker KM (2001) Parasite resistance and genetic variation in the endangered Gila topminow. Animal Conservation, 4, 103 109.
-
(2001)
Animal Conservation
, vol.4
, pp. 103-109
-
-
Hedrick, P.W.1
Kim, T.J.2
Parker, K.M.3
-
39
-
-
0034126368
-
MHC class II pseudogene and genomic signature of a 32-kb cosmid in the house finch (Carpodacus mexicanus)
-
Hess CM, Gasper J, Hoekstra HE, Hill CE, Edwards SV (2000) MHC class II pseudogene and genomic signature of a 32-kb cosmid in the house finch (Carpodacus mexicanus). Genome Research, 10, 613 623.
-
(2000)
Genome Research
, vol.10
, pp. 613-623
-
-
Hess, C.M.1
Gasper, J.2
Hoekstra, H.E.3
Hill, C.E.4
Edwards, S.V.5
-
40
-
-
0001134081
-
HLA association with malaria in Africa: Some implications for MHC evolution
-
In: (eds. Klein, J., Klein, D. pp. Springer, Berlin and Heidelberg.
-
Hill AVS (1991) HLA association with malaria in Africa: some implications for MHC evolution. In : Molecular Evolution of the Major Histcompatibility Complex (eds Klein J, Klein D pp. 403 419. Springer, Berlin and Heidelberg.
-
(1991)
Molecular Evolution of the Major Histcompatibility Complex
, pp. 403-419
-
-
Hill, A.V.S.1
-
41
-
-
0031918872
-
The immunogenetics of human infectious diseases
-
Hill AVS (1998) The immunogenetics of human infectious diseases. Annual Reviews of Immunology, 16, 593 617.
-
(1998)
Annual Reviews of Immunology
, vol.16
, pp. 593-617
-
-
Hill, A.V.S.1
-
42
-
-
0026709389
-
Estimation of levels of gene flow from DNA sequence data
-
Hudson RR, Slatkin M, Maddison WP (1992) Estimation of levels of gene flow from DNA sequence data. Genetics, 132, 583 589.
-
(1992)
Genetics
, vol.132
, pp. 583-589
-
-
Hudson, R.R.1
Slatkin, M.2
Maddison, W.P.3
-
43
-
-
84985801111
-
MHC polymorphism and the design of captive breeding programs
-
Hughes AL (1991) MHC polymorphism and the design of captive breeding programs. Conservation Biology, 5, 249 251.
-
(1991)
Conservation Biology
, vol.5
, pp. 249-251
-
-
Hughes, A.L.1
-
44
-
-
0026575161
-
Maintenance of MHC polymorphism
-
Hughes AL, Nei M (1992) Maintenance of MHC polymorphism. Nature, 355, 402 403.
-
(1992)
Nature
, vol.355
, pp. 402-403
-
-
Hughes, A.L.1
Nei, M.2
-
45
-
-
30744470609
-
Application of phylogenetic networks in evolutionary studies
-
Huson H, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution, 23, 254 267.
-
(2006)
Molecular Biology and Evolution
, vol.23
, pp. 254-267
-
-
Huson, H.1
Bryant, D.2
-
46
-
-
0034013492
-
The major and a minor class II beta-chain (B-LB) gene flank the Tapasin gene in the B-F/B-L region of the chicken major histocompatibility complex
-
Jacob JP, Milne S, Beck S, Kaufman J (2000) The major and a minor class II beta-chain (B-LB) gene flank the Tapasin gene in the B-F/B-L region of the chicken major histocompatibility complex. Immunogenetics, 51, 138 147.
-
(2000)
Immunogenetics
, vol.51
, pp. 138-147
-
-
Jacob, J.P.1
Milne, S.2
Beck, S.3
Kaufman, J.4
-
47
-
-
3242671787
-
Natural selection of the major histocompatibility complex (MHC) in Hawaiian honeycreepers (Drepanidinae
-
Jarvi SI, Tarr CL, McIntosh CE, Atkinson CT, Fleischer RC (2004) Natural selection of the major histocompatibility complex (MHC) in Hawaiian honeycreepers (Drepanidinae). Molecular Ecology, 13, 2157 2168.
-
(2004)
Molecular Ecology
, vol.13
, pp. 2157-2168
-
-
Jarvi, S.I.1
Tarr, C.L.2
McIntosh, C.E.3
Atkinson, C.T.4
Fleischer, R.C.5
-
48
-
-
0030781241
-
The 'minimal essential MHC' revisited: Both peptide-binding and cell surface expression level of MHC molecules are polymorphisms selected by pathogens in chickens
-
Kaufman J, Salomonsen J (1997) The 'minimal essential MHC' revisited: both peptide-binding and cell surface expression level of MHC molecules are polymorphisms selected by pathogens in chickens. Hereditas, 127, 67 73.
-
(1997)
Hereditas
, vol.127
, pp. 67-73
-
-
Kaufman, J.1
Salomonsen, J.2
-
50
-
-
0025276271
-
Nomenclature for the major histocompatibility complexes of different species: A proposal
-
Klein J, Bontrop RE, Dawkins RL et al. (1990) Nomenclature for the major histocompatibility complexes of different species: a proposal. Immunogenetics, 31, 217 219.
-
(1990)
Immunogenetics
, vol.31
, pp. 217-219
-
-
Klein, J.1
Bontrop, R.E.2
Dawkins, R.L.3
-
51
-
-
2342561929
-
Definition of supertypes for HLA molecules using clustering specific matrices
-
Lund O, Nielsen M, Kesmir C, Petersen AG, Lundegaad C, Worning P, Sylvester-Hvid C, Lamberth K, Røder G, Justesen S, Buus S, Brunak S (2004) Definition of supertypes for HLA molecules using clustering specific matrices. Immunogenetics, 55, 797 810.
-
(2004)
Immunogenetics
, vol.55
, pp. 797-810
-
-
Lund, O.1
Nielsen, M.2
Kesmir, C.3
Petersen, A.G.4
Lundegaad, C.5
Worning, P.6
Sylvester-Hvid, C.7
Lamberth, K.8
Røder, G.9
Justesen, S.10
Buus, S.11
Brunak, S.12
-
52
-
-
3242730562
-
Population genetics after fragmentation: The case of the endangered Spanish imperial eagle (Aquila adalberti
-
Martínez-Cruz B, Godoy JA, Negro JJ (2004) Population genetics after fragmentation: the case of the endangered Spanish imperial eagle (Aquila adalberti). Molecular Ecology, 13, 2243 2255.
-
(2004)
Molecular Ecology
, vol.13
, pp. 2243-2255
-
-
Martínez-Cruz, B.1
Godoy, J.A.2
Negro, J.J.3
-
53
-
-
24944536197
-
Comparative host-parsite population structures: Disentangling prospecting and dispersal in the black-legged kittiwake Rissa tridactyla
-
McCoy KD, Boulinier T, Tirard C (2005) Comparative host-parsite population structures: disentangling prospecting and dispersal in the black-legged kittiwake Rissa tridactyla. Molecular Ecology, 14, 2825 2838.
-
(2005)
Molecular Ecology
, vol.14
, pp. 2825-2838
-
-
McCoy, K.D.1
Boulinier, T.2
Tirard, C.3
-
54
-
-
29144440320
-
Characterization of MHC class II genes from an ancient reptile lineage, Sphenodon (tuatara)
-
Miller HC, Belov K, Daugherty CH (2005) Characterization of MHC class II genes from an ancient reptile lineage, Sphenodon (tuatara). Immunogenetics, 57, 883 891.
-
(2005)
Immunogenetics
, vol.57
, pp. 883-891
-
-
Miller, H.C.1
Belov, K.2
Daugherty, C.H.3
-
55
-
-
0035544477
-
Geographic heterogeneity in natural selection on an MHC locus in sockeye salmon
-
Miller KM, Kaukinen KH, Beacham TD, Withler RE (2001) Geographic heterogeneity in natural selection on an MHC locus in sockeye salmon. Genetica, 111, 237 257.
-
(2001)
Genetica
, vol.111
, pp. 237-257
-
-
Miller, K.M.1
Kaukinen, K.H.2
Beacham, T.D.3
Withler, R.E.4
-
56
-
-
9644255666
-
Genetic drift outweighs balancing selection in shaping post-bottleneck major histocompatibility complex variation in New Zealand robins (Petroicidae)
-
Miller HC, Lambert DM (2004a) Genetic drift outweighs balancing selection in shaping post-bottleneck major histocompatibility complex variation in New Zealand robins (Petroicidae). Molecular Ecology, 13, 3709 3721.
-
(2004)
Molecular Ecology
, vol.13
, pp. 3709-3721
-
-
Miller, H.C.1
Lambert, D.M.2
-
57
-
-
3142731513
-
Gene duplication and gene conversion in class II MHC genes of New Zealand robins (Petroicidae
-
Miller HC, Lambert DM (2004b) Gene duplication and gene conversion in class II MHC genes of New Zealand robins (Petroicidae). Immunogenetics, 56, 178 191.
-
(2004)
Immunogenetics
, vol.56
, pp. 178-191
-
-
Miller, H.C.1
Lambert, D.M.2
-
58
-
-
0030829222
-
MHC diversity in Pacific salmon: Population structure and trans-species allelism
-
Miller KM, Whitler RE (1997) MHC diversity in Pacific salmon: population structure and trans-species allelism. Hereditas, 127, 83 95.
-
(1997)
Hereditas
, vol.127
, pp. 83-95
-
-
Miller, K.M.1
Whitler, R.E.2
-
59
-
-
0031260370
-
Population differentiation at MHC genes in chinook salmon Oncorhynchus tshawytscha
-
Miller KM, Whitler RE, Beacham TD (1997) Population differentiation at MHC genes in chinook salmon Oncorhynchus tshawytscha. Molecular Ecology, 6, 937 954.
-
(1997)
Molecular Ecology
, vol.6
, pp. 937-954
-
-
Miller, K.M.1
Whitler, R.E.2
Beacham, T.D.3
-
60
-
-
5344277488
-
Evolution of MHC-DRB class II polymorphism in the genus Apodemus and a comparison of DRB sequences within the family Muridae (Mammalia: Rodentia
-
Musolf K, Meyer-Lucht Y, Sommer S (2004) Evolution of MHC-DRB class II polymorphism in the genus Apodemus and a comparison of DRB sequences within the family Muridae (Mammalia: Rodentia). Immunogenetics, 56, 420 426.
-
(2004)
Immunogenetics
, vol.56
, pp. 420-426
-
-
Musolf, K.1
Meyer-Lucht, Y.2
Sommer, S.3
-
61
-
-
0030867404
-
Causes of natal dispersal in the lesser kestrel: Inbreeding avoidance or resource competition?
-
Negro JJ, Hiraldo F, Donazar JA (1997) Causes of natal dispersal in the lesser kestrel: inbreeding avoidance or resource competition? Journal of Animal Ecology, 66, 640 648.
-
(1997)
Journal of Animal Ecology
, vol.66
, pp. 640-648
-
-
Negro, J.J.1
Hiraldo, F.2
Donazar, J.A.3
-
62
-
-
0033994645
-
Genetic relationship in the peregrine falcon (Falco peregrinus) analysed by microsatellite DNA markers
-
Nesje M, Roed KH, Lifjeld JT, Lindberg P, Steens OF (2000) Genetic relationship in the peregrine falcon (Falco peregrinus) analysed by microsatellite DNA markers. Molecular Ecology, 9, 53 60.
-
(2000)
Molecular Ecology
, vol.9
, pp. 53-60
-
-
Nesje, M.1
Roed, K.H.2
Lifjeld, J.T.3
Lindberg, P.4
Steens, O.F.5
-
63
-
-
33947498160
-
Phylogeography and population structure of the saker falcon (Falco cherrug) and the influence of hybridization: Mitochondrial and microsatellite data
-
Nittinger F, Gamauf A, Pinsker W, Wink M, Haring E (2007) Phylogeography and population structure of the saker falcon (Falco cherrug) and the influence of hybridization: mitochondrial and microsatellite data. Molecular Ecology, 16, 1497 1151.
-
(2007)
Molecular Ecology
, vol.16
, pp. 1497-1151
-
-
Nittinger, F.1
Gamauf, A.2
Pinsker, W.3
Wink, M.4
Haring, E.5
-
64
-
-
0029310503
-
Microsatellite analysis of population structure in Canadian polar bears
-
Paetkau D, Calvert W, Stirling I, Strobeck C (1995) Microsatellite analysis of population structure in Canadian polar bears. Molecular Ecology, 4, 347 354.
-
(1995)
Molecular Ecology
, vol.4
, pp. 347-354
-
-
Paetkau, D.1
Calvert, W.2
Stirling, I.3
Strobeck, C.4
-
65
-
-
0037143716
-
MHC heterozygosity confers a selective advantage against multiple-strain infections
-
Penn DJ, Damjanovich K, Potts WK (2002) MHC heterozygosity confers a selective advantage against multiple-strain infections. PNAS, 99, 11260 11264.
-
(2002)
PNAS
, vol.99
, pp. 11260-11264
-
-
Penn, D.J.1
Damjanovich, K.2
Potts, W.K.3
-
66
-
-
0033036460
-
The evolution of mating preferences and major histocompatibility genes
-
Penn DJ, Potts WK (1999) The evolution of mating preferences and major histocompatibility genes. American Naturalist, 153, 145 164.
-
(1999)
American Naturalist
, vol.153
, pp. 145-164
-
-
Penn, D.J.1
Potts, W.K.2
-
67
-
-
1042267712
-
Major histocompatibility complex B-LB gene variation in red grouse, Lagopus lagopus scoticus.
-
Piertney SB (2003) Major histocompatibility complex B-LB gene variation in red grouse, Lagopus lagopus scoticus. Wildlife Biology, 9, 251 259.
-
(2003)
Wildlife Biology
, vol.9
, pp. 251-259
-
-
Piertney, S.B.1
-
68
-
-
33644998297
-
The evolutionary ecology of the major histocompatibility complex
-
Piertney SB, Oliver MK (2006) The evolutionary ecology of the major histocompatibility complex. Heredity, 96, 7 21.
-
(2006)
Heredity
, vol.96
, pp. 7-21
-
-
Piertney, S.B.1
Oliver, M.K.2
-
69
-
-
0000262278
-
Genepop (version 1.2): Population genetics software for exact tests and ecumenicism
-
Raymond M, Rousset F (1995) genepop (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248 249.
-
(1995)
Journal of Heredity
, vol.86
, pp. 248-249
-
-
Raymond, M.1
Rousset, F.2
-
70
-
-
0038725529
-
Relative roles of mutation and recombination in generating allelic polymorphism at MHC class II locus in Peromyscus maniculatus
-
Richman A, Herrera LG, Nash D, Schierup MH (2003) Relative roles of mutation and recombination in generating allelic polymorphism at MHC class II locus in Peromyscus maniculatus. Genetical Research, 82, 89 99.
-
(2003)
Genetical Research
, vol.82
, pp. 89-99
-
-
Richman, A.1
Herrera, L.G.2
Nash, D.3
Schierup, M.H.4
-
71
-
-
0034096818
-
IMGT/HLA database - A sequence database for the human major histocompatibility complex
-
Robinson J, Malik A, Parham P, Bodmer JG, Marsh SGE (2000) IMGT/HLA database - a sequence database for the human major histocompatibility complex. Tissue Antigens, 55, 280 287.
-
(2000)
Tissue Antigens
, vol.55
, pp. 280-287
-
-
Robinson, J.1
Malik, A.2
Parham, P.3
Bodmer, J.G.4
Marsh, S.G.E.5
-
72
-
-
0347513220
-
Dnasp, DNA polymorphism analyses by the coalescent and other methods
-
Rozas J, Sánchez-DelBarrio JC, Messeguer X, Rozas R (2003) dnasp, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics, 19, 2496 2497.
-
(2003)
Bioinformatics
, vol.19
, pp. 2496-2497
-
-
Rozas, J.1
Sánchez-Delbarrio, J.C.2
Messeguer, X.3
Rozas, R.4
-
73
-
-
0037656158
-
Dispersal within a spatially structured population of lesser kestrel: The role of spatial isolation and conspecific attraction
-
Serrano D, Tella JL (2003) Dispersal within a spatially structured population of lesser kestrel: the role of spatial isolation and conspecific attraction. Journal of Animal Ecology, 72, 400 410.
-
(2003)
Journal of Animal Ecology
, vol.72
, pp. 400-410
-
-
Serrano, D.1
Tella, J.L.2
-
74
-
-
0034925069
-
Factors affecting breeding dispersal in the facultatively colonial Lesser kestrel: Individual experience vs conspecific cues
-
Serrano D, Tella JL, Forero MG, Donázar JA (2001) Factors affecting breeding dispersal in the facultatively colonial Lesser kestrel: individual experience vs conspecific cues. Journal of Animal Ecology, 70, 568 578.
-
(2001)
Journal of Animal Ecology
, vol.70
, pp. 568-578
-
-
Serrano, D.1
Tella, J.L.2
Forero, M.G.3
Donázar, J.A.4
-
75
-
-
27744606052
-
The importance of immune gene variability in evolutionary ecology and evolution
-
Sommer S (2005) The importance of immune gene variability in evolutionary ecology and evolution. Frontiers in Zoology, 2, 16.
-
(2005)
Frontiers in Zoology
, vol.2
, pp. 16
-
-
Sommer, S.1
-
76
-
-
0031861299
-
Conflicts between lesser kestrel conservation and European agricultural policies identified by habitat use analyses
-
Tella JL, Forero MG, Hiraldo F, Donázar JA (1998) Conflicts between lesser kestrel conservation and European agricultural policies identified by habitat use analyses. Conservation Biology, 12, 593 604.
-
(1998)
Conservation Biology
, vol.12
, pp. 593-604
-
-
Tella, J.L.1
Forero, M.G.2
Hiraldo, F.3
Donázar, J.A.4
-
78
-
-
0038379170
-
Advantage of rare HLA supertype in HIV disease progression
-
Trachtenberg E, Korber B, Sollars C et al 2003) Advantage of rare HLA supertype in HIV disease progression. Nature Medicine, 9, 928 935.
-
(2003)
Nature Medicine
, vol.9
, pp. 928-935
-
-
Trachtenberg, E.1
Korber, B.2
Sollars, C.3
Al, E.4
-
79
-
-
12044254346
-
Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift
-
Wagner A, Blackstone N, Cartwright P et al 1994) Surveys of gene families using polymerase chain reaction: PCR selection and PCR drift. Systematic Biology, 43, 250 261.
-
(1994)
Systematic Biology
, vol.43
, pp. 250-261
-
-
Wagner, A.1
Blackstone, N.2
Cartwright, P.3
Al, E.4
-
80
-
-
33645016750
-
Genetic variation in MHC class II expression and interactions with MHC sequence polymorphism in three-spined sticklebacks
-
Wegner KM, Kalbe M, Rauch G, Kurtz J, Schaschl H, Reusch TBH (2006) Genetic variation in MHC class II expression and interactions with MHC sequence polymorphism in three-spined sticklebacks. Molecular Ecology, 15, 1153 1164.
-
(2006)
Molecular Ecology
, vol.15
, pp. 1153-1164
-
-
Wegner, K.M.1
Kalbe, M.2
Rauch, G.3
Kurtz, J.4
Schaschl, H.5
Reusch, T.B.H.6
-
81
-
-
3042698704
-
MHC class I typing in a songbird with numerous loci and high polymorphism using motif-specific PCR and DGGE
-
Westerdahl H, Wittzell H, von Schantz T, Bensch S (2004) MHC class I typing in a songbird with numerous loci and high polymorphism using motif-specific PCR and DGGE. Heredity, 92, 534 542.
-
(2004)
Heredity
, vol.92
, pp. 534-542
-
-
Westerdahl, H.1
Wittzell, H.2
Von Schantz, T.3
Bensch, S.4
-
82
-
-
33645229840
-
Estimating diversifying selection and functional constraint in the presence of recombination
-
Wilson DJ, McVean G (2006) Estimating diversifying selection and functional constraint in the presence of recombination. Genetics, 172, 1411 1425.
-
(2006)
Genetics
, vol.172
, pp. 1411-1425
-
-
Wilson, D.J.1
McVean, G.2
-
83
-
-
28444467498
-
-
: edsRaptors Worldwide, pp. WWGBP/MME, Berlin.
-
Wink M, Sauer-Gürth H, Pepler D (2004) Phylogeographic relationships of the lesser kestrel Falco naumanni in breeding and wintering quarters inferred from nucleotide sequences of the mitochondrial cytochrome b gene. In : RD Chancellor BU Meyburg (eds Raptors Worldwide, pp. 505 510. WWGBP/MME, Berlin.
-
(2004)
Phylogeographic Relationships of the Lesser Kestrel Falco Naumanni in Breeding and Wintering Quarters Inferred from Nucleotide Sequences of the Mitochondrial Cytochrome B Gene. in
, pp. 505-510
-
-
Wink, M.1
Sauer-Gürth, H.2
Pepler, D.3
Wink, M.4
Sauer-Gürth, H.5
Pepler, D.6
-
84
-
-
0032933802
-
Concerted evolution of two MHC class II B loci in pheasants and domestic chickens
-
Witzell H, Bernot A, Auffrey C, Zoorob R (1999) Concerted evolution of two MHC class II B loci in pheasants and domestic chickens. Molecular Biology and Evolution, 16, 479 490.
-
(1999)
Molecular Biology and Evolution
, vol.16
, pp. 479-490
-
-
Witzell, H.1
Bernot, A.2
Auffrey, C.3
Zoorob, R.4
-
86
-
-
0032605010
-
Analysis of genetic polymorphism in the major histocompatibility complex of Japanese quail
-
Ye X, Zhu J, Velleman SG, Bacon WL, Nestor KE (1999) Analysis of genetic polymorphism in the major histocompatibility complex of Japanese quail. Poultry Science, 78, 8 14.
-
(1999)
Poultry Science
, vol.78
, pp. 8-14
-
-
Ye, X.1
Zhu, J.2
Velleman, S.G.3
Bacon, W.L.4
Nestor, K.E.5
-
87
-
-
0025210143
-
Organization of a functional chicken class II B gene
-
Miguel Alcaide is interested in the investigation of adaptive genetic variation in vertebrates. Scott Edwards and his lab are interested in the population genetics, comparative genomics and evolution of birds and relatives. Juan José Negro although initially trained as a behavioural ecologist, is also interested in genetic variability issues, hybridization and genetic erosion in small populations. David Serrano is interested in behavioural ecology, demography and population ecology. His main research lines focus of animal dispersal and evolution of avian coloniality. José L. Tella is interested in a variety of evolutionary, behavioural and conservation ecology issues, including the demographic, genetic, physiological and cultural effects of habitat fragmentation on bird populations. Primer sequences for locus Cl347 (F: TGTGTGTGTAAGGTTGCCAAA; R: CGTTCTCAACATGCCAGTTT) and Cl58 (F: TGTGTCTCAGTGGGGAAAAA; R: TGCTTTGGTGCTGAAGAAAC).
-
Zoorob R, Behar G, Kroemer G, Auffrey C (1990) Organization of a functional chicken class II B gene. Immunogenetics, 31, 179 187.
-
(1990)
Immunogenetics
, vol.31
, pp. 179-187
-
-
Zoorob, R.1
Behar, G.2
Kroemer, G.3
Auffrey, C.4
|