메뉴 건너뛰기




Volumn 16, Issue 1, 2006, Pages 213-216

Modular polyketide synthases: Investigating intermodular communication using 6 deoxyerythronolide B synthase module 2

Author keywords

Biosynthesis; Molecular recognition; Polyketides

Indexed keywords

6 DEOXYERYTHRONOLIDE B SYNTHASE; MUTANT PROTEIN; POLYKETIDE SYNTHASE; SYNTHETASE; UNCLASSIFIED DRUG;

EID: 27744582590     PISSN: 0960894X     EISSN: None     Source Type: Journal    
DOI: 10.1016/j.bmcl.2005.09.017     Document Type: Article
Times cited : (4)

References (22)
  • 12
    • 27744468579 scopus 로고    scopus 로고
    • note
    • Plasmid p28N3M2TE was prepared as follows: the mod 2 gene was excised from pPK22 [Ref. 4] using the restriction enzymes BsaBI and SpeI. The gene was ligated into the pUC18-based vector pST117 similarly digested. The resulting construct (pUCN3M2TE) was digested with NdeI and EcoRI and the gene insert was ligated into pET28A to yield p28N3M2TE.
  • 14
    • 27744441837 scopus 로고    scopus 로고
    • note
    • For individual modules, as well as each module-module pair, assays were carried out over a range of diketide concentrations, as previously described, and the steady-state kinetic parameters were determined by direct fitting of the data to the Michaelis-Menten equation by non-linear, least squares regression. Although satisfactory kinetic fits were obtained over the entire range of individual module-module combinations, attempts to fit the data to standard inhibition models as a function of protein ratios were unsuccessful.
  • 15
    • 27744545463 scopus 로고    scopus 로고
    • note
    • The inactive C2200A mutant of (N5)Mod2(C2) was prepared using the Stratagene QuikChange mutagenesis kit with plasmid pPK22 as template. Forward primer: GCCGGACGGCCGGGCAAAGCCCTTCTCGGAC; reverse primer: GTCCGAGAAGGGCTTTGCCCGGCCGTCCGGC. The resulting plasmid was digested with NdeI and ScaI, and the excised DNA insert was ligated into a similarly digested wt pPK22 and the sequence of the mutant was verified by dideoxy sequencing.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.