메뉴 건너뛰기




Volumn 278, Issue 5338, 1997, Pages 687-689

Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt

Author keywords

[No Author keywords available]

Indexed keywords

INTERLEUKIN 3; PHOSPHATIDYLINOSITOL 3 KINASE; PROTEIN BCL 2; PROTEIN SERINE THREONINE KINASE;

EID: 1842333237     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.278.5338.687     Document Type: Article
Times cited : (2014)

References (29)
  • 2
    • 0028809209 scopus 로고
    • E. Yang, et al., Cell 80, 285 (1995).
    • (1995) Cell , vol.80 , pp. 285
    • Yang, E.1
  • 4
    • 0026504147 scopus 로고
    • M. C. Raff, Nature 356, 397 (1992); M. C. Raff et al., Science 262, 695 (1993); M. D. Jacobson, M. Weil, M. C. Raff, Cell 88, 347 (1997).
    • (1992) Nature , vol.356 , pp. 397
    • Raff, M.C.1
  • 5
    • 0027373764 scopus 로고
    • M. C. Raff, Nature 356, 397 (1992); M. C. Raff et al., Science 262, 695 (1993); M. D. Jacobson, M. Weil, M. C. Raff, Cell 88, 347 (1997).
    • (1993) Science , vol.262 , pp. 695
    • Raff, M.C.1
  • 6
    • 0030947095 scopus 로고    scopus 로고
    • M. C. Raff, Nature 356, 397 (1992); M. C. Raff et al., Science 262, 695 (1993); M. D. Jacobson, M. Weil, M. C. Raff, Cell 88, 347 (1997).
    • (1997) Cell , vol.88 , pp. 347
    • Jacobson, M.D.1    Weil, M.2    Raff, M.C.3
  • 7
    • 0028963084 scopus 로고    scopus 로고
    • R. Yao and G. M. Cooper, Science 267, 2003 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, Cell 88, 355 (1997).
    • (1995) Science , vol.267 , pp. 2003
    • Yao, R.1    Cooper, G.M.2
  • 9
    • 0029079275 scopus 로고
    • T. F. Franke et al., Cell 81, 727 (1995).
    • (1995) Cell , vol.81 , pp. 727
    • Franke, T.F.1
  • 10
    • 0029160069 scopus 로고
    • B. M. T. Burgering and P. J. Coffer, Nature 376, 599 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997).
    • (1995) Nature , vol.376 , pp. 599
    • Burgering, B.M.T.1    Coffer, P.J.2
  • 12
    • 0030975196 scopus 로고    scopus 로고
    • J. K. Klarlund et al., Science 275, 1927 (1997); A. Toker and L. C. Cantley, Nature 387, 673 (1997).
    • (1997) Science , vol.275 , pp. 1927
    • Klarlund, J.K.1
  • 13
    • 0030992837 scopus 로고    scopus 로고
    • J. K. Klarlund et al., Science 275, 1927 (1997); A. Toker and L. C. Cantley, Nature 387, 673 (1997).
    • (1997) Nature , vol.387 , pp. 673
    • Toker, A.1    Cantley, L.C.2
  • 15
    • 0031053586 scopus 로고    scopus 로고
    • H. Dudek et al., ibid. 275, 661 (1997); A. Kauffmann-Zeh et al., Nature 385, 544 (1997).
    • (1997) Science , vol.275 , pp. 661
    • Dudek, H.1
  • 16
    • 0031028730 scopus 로고    scopus 로고
    • H. Dudek et al., ibid. 275, 661 (1997); A. Kauffmann-Zeh et al., Nature 385, 544 (1997).
    • (1997) Nature , vol.385 , pp. 544
    • Kauffmann-Zeh, A.1
  • 18
    • 0030904561 scopus 로고    scopus 로고
    • N. N. Ahmed, H. L. Grimes, A. Bellacosa, T. O. Chan, P. Tsichlis, Proc. Natl. Acad. Sci. U.S.A. 94, 3627 (1997); S. G. Kennedy et al., Genes Dev. 11, 701 (1997).
    • (1997) Genes Dev. , vol.11 , pp. 701
    • Kennedy, S.G.1
  • 19
    • 85069028100 scopus 로고    scopus 로고
    • note
    • The mouse BAD cDNA containing the coding sequence was amplified by reverse transcription polymerase chain reaction (PCR) with specific primers (5′-AAAGATCTAGAATGGGAACCCCAAAGCAGCCCTCGCTG-3′ and 5′-TTGAATTCACTGGGAGGGGGTGGAGCCTCCTTTG-3′) and ligated in frame into the pcDNA3 vector (Invitrogen) containing an AU1-tag epitope. The authenticity of all constructs was confirmed by dideoxy sequencing. FL5.12 cells were transfected by electroporation (960 μF, 250 V) with the pcDNA3-AU1-BAD construct alone or in combination with a human Bcl-2-expressing plasmid (pSFFV-Flag-Bcl-2) and selected with G418 (1 mg/ml). After selection, expression was assessed in the bulk population as well as in independent clones by flow cytometry.
  • 20
  • 23
    • 85069031499 scopus 로고    scopus 로고
    • note
    • 136 to Ala mutations was generated by site-directed mutagenesis with the use of PCR (5′- CAGTGCGTACCCAGCGGGGACCGAGGAGGATGAAGGGTAGGAGGAGGAGTCTAGCCCTTTTCGAGGACGCTCGCGTGCGG CTCCC-3′ and 5′- GGGAGCCGCACGCGAGCGTCCTCGAAAAGGGCTAAGCTCCTCCTCCATCCCTTCATCCTCCTCGGTCCCCGCTGGGTAGC GACTG-3′), then subcloned into the pET-30a(+) plasmid and purified as WT rBAD. The authenticity of all constructs was confirmed by dideoxy sequencing.
  • 26
    • 0029127042 scopus 로고
    • S. P. Staal, Proc. Natl. Acad. Sci. U.S.A. 84, 5034 (1987); A. Bellacosa et al., Int. J. Cancer 64, 280 (1995).
    • (1995) Int. J. Cancer , vol.64 , pp. 280
    • Bellacosa, A.1
  • 27
    • 85069023645 scopus 로고    scopus 로고
    • note
    • 2, 1 mM EGTA, aprotinin (2 μg/ml), leupeptin (2 μg/ml), 1 mM phenylmethylsulfonyl fluoride, and 50 mM NaF]. BAD was immunoprecipitated with an antibody to AU1 (Babco); immunocomplexes were recovered with protein G-Sepharose and resolved by SDS-polyacrylamide gel electrophoresis (PAGE). Proteins were transferred to a nitrocellulose membrane and exposed to a Phosphorlmager screen (Molecular Dynamics) to quantitate the radioactivity incorporated into the BAD protein.
  • 28
    • 85069009478 scopus 로고    scopus 로고
    • Single-letter abbreviations for the amino acid residues are as follows: A, Ala; E, Glu; F, Phe; G, Gly; H, His; I, Ile; M, Met; N, Asn; P, Pro; R, Arg; S, Ser; T, Thr; V, Val; and Y, Tyr
    • Single-letter abbreviations for the amino acid residues are as follows: A, Ala; E, Glu; F, Phe; G, Gly; H, His; I, Ile; M, Met; N, Asn; P, Pro; R, Arg; S, Ser; T, Thr; V, Val; and Y, Tyr.
  • 29
    • 85069027581 scopus 로고    scopus 로고
    • note
    • We thank T. F. Franke, M. Andjelkovich, and P. Tsichlis for reagents and R. Perez-Ballestero, M. Benedict, and N. Inohara for valuable discussions and critical review of the manuscript. Supported in part by NIH grant CA-64556, the University of Michigan/Parke-Davis Fellowship Program (L.d.P.), a Spanish Ministry of Science and Education Postdoctoral Fellowship (M.G.-G.), and an NIH Research Career Development Award (G.N.)


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.