메뉴 건너뛰기




Volumn 275, Issue 5308, 1997, Pages 1927-1930

Signaling by phosphoinositide-3,4,5-trisphosphate through proteins containing pleckstrin and sec7 homology domains

Author keywords

[No Author keywords available]

Indexed keywords

AMINO ACID; CELL SURFACE RECEPTOR; COMPLEMENTARY DNA; GUANINE NUCLEOTIDE; GUANINE NUCLEOTIDE BINDING PROTEIN; HYBRID PROTEIN; INTEGRIN; PHOSPHATIDYLINOSITIDE; PHOSPHOTRANSFERASE; PLECKSTRIN; PROTEIN;

EID: 0030975196     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.275.5308.1927     Document Type: Article
Times cited : (377)

References (48)
  • 2
    • 0027905021 scopus 로고
    • P. De Camilli, S. D. Emr, P. S. McPherson, P. Novick, Science 271, 1533 (1996); P. V. Schu et al., ibid. 260, 88 (1993).
    • (1993) Science , vol.260 , pp. 88
    • Schu, P.V.1
  • 3
    • 0028981018 scopus 로고
    • S. Volinia et al., EMBO J. 14, 3339 (1995).
    • (1995) EMBO J. , vol.14 , pp. 3339
    • Volinia, S.1
  • 4
    • 0028178428 scopus 로고    scopus 로고
    • P. Hu and J. Schlessinger, Mol. Cell. Biol. 14, 2577 (1994); I. D. Hiles et al., Cell 70, 419 (1992); J. A. Escobedo et al., ibid. 65, 75 (1991); E. Y. Skolnik et al., ibid., p. 83.
    • (1994) Mol. Cell. Biol. , vol.14 , pp. 2577
    • Hu, P.1    Schlessinger, J.2
  • 5
    • 0026720350 scopus 로고
    • P. Hu and J. Schlessinger, Mol. Cell. Biol. 14, 2577 (1994); I. D. Hiles et al., Cell 70, 419 (1992); J. A. Escobedo et al., ibid. 65, 75 (1991); E. Y. Skolnik et al., ibid., p. 83.
    • (1992) Cell , vol.70 , pp. 419
    • Hiles, I.D.1
  • 6
    • 0025727594 scopus 로고
    • P. Hu and J. Schlessinger, Mol. Cell. Biol. 14, 2577 (1994); I. D. Hiles et al., Cell 70, 419 (1992); J. A. Escobedo et al., ibid. 65, 75 (1991); E. Y. Skolnik et al., ibid., p. 83.
    • (1991) Cell , vol.65 , pp. 75
    • Escobedo, J.A.1
  • 7
    • 0028178428 scopus 로고    scopus 로고
    • P. Hu and J. Schlessinger, Mol. Cell. Biol. 14, 2577 (1994); I. D. Hiles et al., Cell 70, 419 (1992); J. A. Escobedo et al., ibid. 65, 75 (1991); E. Y. Skolnik et al., ibid., p. 83.
    • Cell , pp. 83
    • Skolnik, E.Y.1
  • 8
    • 0029090212 scopus 로고
    • B. Stoyanov et al., Science 269, 690 (1995).
    • (1995) Science , vol.269 , pp. 690
    • Stoyanov, B.1
  • 12
    • 0029320454 scopus 로고
    • P. J. Parker, Curr. Biol. 5, 577 (1995); S. Wennstrom et al., ibid. 4, 385 (1994).
    • (1995) Curr. Biol. , vol.5 , pp. 577
    • Parker, P.J.1
  • 13
    • 0028429961 scopus 로고
    • P. J. Parker, Curr. Biol. 5, 577 (1995); S. Wennstrom et al., ibid. 4, 385 (1994).
    • (1994) Curr. Biol. , vol.4 , pp. 385
    • Wennstrom, S.1
  • 15
    • 0028055272 scopus 로고
    • M. Thelen, M. Uguocioni, L. Bosiger, Biochem. Biophys. Res. Commun. 217, 1255 (1995); V. Kundra et al., Nature 367, 474 (1994).
    • (1994) Nature , vol.367 , pp. 474
    • Kundra, V.1
  • 17
    • 0027374488 scopus 로고
    • J. D. Bonnema, L. M. Karnitz, R. A. Schoon, R. T. Abraham, P. J. Leibson, J. Exp. Med. 180, 1427 (1994); H. Yano et al., J. Biol. Chem. 268, 25846 (1993).
    • (1993) J. Biol. Chem. , vol.268 , pp. 25846
    • Yano, H.1
  • 19
    • 0027249346 scopus 로고
    • T. Okada, Y. Kawano, T. Sakakibara, O. Hazeki, M. Ui, J. Biol. Chem. 269, 3568 (1994); F. Kanai et al., Biochem. Biophys. Res. Commun. 195, 762 (1993).
    • (1993) Biochem. Biophys. Res. Commun. , vol.195 , pp. 762
    • Kanai, F.1
  • 24
    • 0029993517 scopus 로고    scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1996) Biochem. J. , vol.315 , pp. 709
    • James, S.R.1
  • 25
    • 0029079275 scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1995) Cell , vol.81 , pp. 727
    • Franke, T.F.1
  • 26
    • 0031039024 scopus 로고    scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1997) Science , vol.275 , pp. 665
    • Franke, T.F.1    Kaplan, D.R.2    Cantley, L.C.3    Toker, A.4
  • 27
    • 0031015986 scopus 로고    scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1997) Mol. Cell. Biol. , vol.17 , pp. 338
    • Klippel, A.1    Kavanaugh, W.M.2    Pot, D.3    Williams, L.T.4
  • 28
    • 10544219605 scopus 로고    scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1996) EMBOJ. , vol.15 , pp. 6241
    • Salim, K.1
  • 29
    • 0029824848 scopus 로고    scopus 로고
    • S. R. James et al., Biochem. J. 315, 709 (1996); T. F. Franke et al., Cell 81, 727 (1995); T. F. Franke, D. R. Kaplan, L. C. Cantley, A. Toker, Science 275, 665 (1997); A. Klippel, W. M. Kavanaugh, D. Pot, L. T. Williams, Mol. Cell. Biol. 17, 338 (1997); K. Salim et al., EMBOJ. 15, 6241 (1996); M. Fukuda, T. Kojima, H. Kabayama, K. Mikoshiba, J. Biol. Chem. 271, 30303 (1996).
    • (1996) J. Biol. Chem. , vol.271 , pp. 30303
    • Fukuda, M.1    Kojima, T.2    Kabayama, H.3    Mikoshiba, K.4
  • 30
    • 0028999052 scopus 로고
    • Q. P. Weng et al., Proc. Natl. Acad. Sci. U.S.A. 92, 5744 (1995); P. R. Shepard, B. T. Nave, K. Siddle, Biochem. J. 305, 25 (1995).
    • (1995) Proc. Natl. Acad. Sci. U.S.A. , vol.92 , pp. 5744
    • Weng, Q.P.1
  • 34
    • 1842342620 scopus 로고    scopus 로고
    • note
    • 2, and 0.5% dithiotreitol] under constant agitation. The filters were then incubated for 30 min in a crystallization bowl with the dissolved lipid in 30 ml of assay buffer at room temperature with labeled mixed brain lipid (2 μCi/ml) and shaken vigorously. The filters were washed with five changes of the same buffer, dried, and subjected to autoradiography.
  • 38
    • 0028322046 scopus 로고
    • D. E. Shevell et al., Cell 77, 1051 (1994); T. Achstetter, A. Franzusoff, C. Field, R. Schekman, J. Biol. Chem. 263, 11711 (1988).
    • (1994) Cell , vol.77 , pp. 1051
    • Shevell, D.E.1
  • 40
    • 0030602819 scopus 로고    scopus 로고
    • W. Kolanus et al., Cell 86, 233 (1996).
    • (1996) Cell , vol.86 , pp. 233
    • Kolanus, W.1
  • 41
    • 0029844904 scopus 로고    scopus 로고
    • P. Chardin et al., Nature 384, 481 (1996).
    • (1996) Nature , vol.384 , pp. 481
    • Chardin, P.1
  • 42
    • 1842384135 scopus 로고    scopus 로고
    • note
    • To generate the GST fusion proteins, we used for the polymerase chain reactions (PCRs) the following primers: GGAATTCCTTCGGCACGAGCGGTG and CCGCTCGAGCGGTGGCTATTTGCTTGTTCCTC for the GST-N (residues 5 to 71 of GRP1) construct; GGAATTCCGACAACCTGACTTCAGTGG and CCGCTCGAGCGGTGTGTGTCAGGTCATTTCC for the GST-Sec7 construct; GGAATTCCTATGAAAGTATCAAGAATGAGC and CCGCTCGAGCGGCTGGATCCTGACATTTACC for the GST-PH construct; and GGAATTCCTTCGGCACGAGCGGTG and CCGCTCGAGCGGCTGGATCCTGACATTTACC for the GST-GRP1 construct. The sequences of the PCR products were verified and cloned into pGEX-5X-3 in the Eco RI and Xba I sites. The cytohesin-1 PH domain corresponding to amino acids 286 to 398 was synthetically prepared by using a total of 16 oligonucleotides. In brief, three double-stranded oligonucleotides (219, 210, and 124 base pairs long) were prepared by annealing sets of either four or six oligonucleotides that contained 15 bases overlapping complementary sequences. Restriction sites (Eco RI at the 5′ ends and Sal I) were created in all the double-stranded oligonucleotides and used to subclone the oligonucleotides into the Puc 19 plasmid. The DNA inserts were excised and ligated in proper order at Stu I and Ban II sites. Finally, the completed PH domain of cytohesin-1 was subcloned into pGEX5X-3 by using Eco RI and Xho I sites. The bacteria expressing the pGEX constructs were lysed, and the fusion proteins were bound to glutathione immobilized on agarose according to standard procedures. The beads were incubated with one volume of 20 mM Hepes, 100 mM NaCl, 1 mM dithiothreitol (H buffer) supplemented with 10 mM glutathione and 1% sodium cholate, and the eluate was dialyzed extensively against H buffer. For binding assays, we bound protein to nitrocellulose with a Bio-Rad BIO-DOT apparatus using 150 pmol per well for binding assays and 7.5 pmol for competition assays. The nitrocellulose was washed in assay buffer, and 3-mm circles of the filters containing the protein were cut out and incubated in 40 μl of assay buffer with the relevant lipids and competitors for 2 hours under constant agitation. The filters were washed four times with 1 ml of assay buffer and counted in a scintillation counter.
  • 48
    • 1842272515 scopus 로고    scopus 로고
    • for assistance in preparation of the manuscript
    • (IRS-1) constructs, and J. Erickson for assistance in preparation of the manuscript.
    • Erickson, J.1


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.