메뉴 건너뛰기




Volumn 289, Issue 5477, 2000, Pages 304-306

An anti-apoptotic role for the p53 family member, p73, during developmental neuron death

Author keywords

[No Author keywords available]

Indexed keywords

PROTEIN P53; PROTEIN P73;

EID: 0034647718     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.289.5477.304     Document Type: Article
Times cited : (418)

References (26)
  • 1
    • 0030941458 scopus 로고    scopus 로고
    • A. J. Levine, Cell 88, 323 (1997).
    • (1997) Cell , vol.88 , pp. 323
    • Levine, A.J.1
  • 5
    • 0030812331 scopus 로고    scopus 로고
    • M. Kaghad et al., Cell 90, 809 (1997).
    • (1997) Cell , vol.90 , pp. 809
    • Kaghad, M.1
  • 7
    • 17544363909 scopus 로고    scopus 로고
    • A. Yang et al., Nature 404, 99 (2000).
    • (2000) Nature , vol.404 , pp. 99
    • Yang, A.1
  • 10
    • 0032161624 scopus 로고    scopus 로고
    • A. Yang et al., Mol. Cell 2, 305 (1998).
    • (1998) Mol. Cell , vol.2 , pp. 305
    • Yang, A.1
  • 11
    • 0033594485 scopus 로고    scopus 로고
    • A. Yang et al., Nature 398, 714 (1999).
    • (1999) Nature , vol.398 , pp. 714
    • Yang, A.1
  • 12
    • 0032531713 scopus 로고    scopus 로고
    • Primers specific to truncated p73 were 5′ATGGGCCCTGTGTATGAATCCTTG3′ and 5′GGTATTGGAAGGGATGACAGGCG3′. Primers specific to full-length p73 were 5′GAGCACCTGTGGAGTTCTCTAGAG3′ and 5′GGTATTGGAAGGGATGACAGGCG3′
    • Total RNA was prepared and RT-PCR performed as described in [X.-M. Yang et al., J. Neurosci. 18, 8369 (1998)]. Primers specific to truncated p73 were 5′ATGGGCCCTGTGTATGAATCCTTG3′ and 5′GGTATTGGAAGGGATGACAGGCG3′. Primers specific to full-length p73 were 5′GAGCACCTGTGGAGTTCTCTAGAG3′ and 5′GGTATTGGAAGGGATGACAGGCG3′.
    • (1998) J. Neurosci. , vol.18 , pp. 8369
    • Yang, X.-M.1
  • 13
    • 0343784410 scopus 로고    scopus 로고
    • data not shown
    • C. D. Pozniak et al., data not shown.
    • Pozniak, C.D.1
  • 14
    • 0343784411 scopus 로고    scopus 로고
    • note
    • Whole brain and sympathetic neurons were lysed and 1D Western blot analysis performed as described using antibody to p73 (1;200) (ER-15; Neomarkers, Union City, CA) (3). Two-dimensional gels were run as per manufacturer's instructions (Amersham Pharmacia Biotech) using lysates of sympathetic neurons infected with adenoviruses expressing full-length human p73α, and mouse ΔN-p73α and ΔN-p73β to standardize the system.
  • 15
    • 0343348678 scopus 로고    scopus 로고
    • note
    • Mice heterozygous for a targeted mutation in the p73 gene (7) were maintained in a c129-Balb/c background. Progeny from p73 heterozygote crosses were screened for the mutant and wild-type alleles with PCR.
  • 16
    • 0343784407 scopus 로고    scopus 로고
    • note
    • Purified cultures of sympathetic neurons were cultured and then withdrawn from NGF as described (3, 19).
  • 17
    • 0343784408 scopus 로고    scopus 로고
    • note
    • Recombinant adenoviruses expressing ΔN-p73α or -β were generated, purified over CsCl, and titered as described (23, 24).
  • 18
    • 0342913496 scopus 로고    scopus 로고
    • note
    • Sympathetic neurons were cultured for 4 to 5 days in 50 ng/ml NGF and then infected with recombinant adenovirus as previously described (3). Three days later, neurons were withdrawn from NGF or were maintained in 10 ng/ml NGF, and MTT survival assays and TUNEL were performed after 2 days as described (25).
  • 21
    • 0343348674 scopus 로고    scopus 로고
    • note
    • For morphometric analysis, the SCGs were prepared and analyzed as previously (3, 19). Sections were stained with toluidine blue or cresyl violet and were analyzed with a computer-based image analysis system that counted every third section.
  • 22
    • 0343348673 scopus 로고    scopus 로고
    • note
    • 2-terminus of ΔN-p73α or ΔN-p73β, and proteins were produced in Escherichia coli. To assess interactions, lysates of 293 cells infected with p53 adenovirus (4) were incubated with the CST fusion proteins for 4 hours at 4°C and were precipitated with glutathione-agarose. Precipitated proteins were analyzed by Western blot analysis with antibody to p53 (DO-1; Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
  • 26
    • 0343784401 scopus 로고    scopus 로고
    • note
    • We thank R. Aloyz, A. Boudreau, F. Arab-Said, and S. Morris for their advice and assistance. C.D.P. and S.R. are supported by Canadian Medical Research Council (MRC) and National Sciences Engineering Research Council of Canada studentships, respectively; D.R.K. is an National Cancer Institute of Canada Scientist; and F.D.M. is an MRC Senior Scientist and Killam Scholar. Supported in part by grants from the MRC to F.D.M. and D.R.K.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.