-
1
-
-
0028311812
-
-
P. Devilee, E. Schuuring, M. J. van de Vijver, C. J. Cornelisse, Crit. Rev. Oncog. 5, 247 (1994).
-
(1994)
Crit. Rev. Oncog.
, vol.5
, pp. 247
-
-
Devilee, P.1
Schuuring, E.2
Van De Vijver, M.J.3
Cornelisse, C.J.4
-
2
-
-
0028874583
-
-
J. J. Isola et al., Am. J. Pathol. 147, 905 (1995); A. Kallioniemi et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); M. Muleris, A. Almeida, M. Gerbault-Seureau, B. Malfoy, B. Dutrillaux, Genes Chromosomes Cancer 10, 160 (1994); M. M. Tanner et al., Cancer Res. 54, 4257 (1994); X.-Y. Guan, P. S. Meltzer, W. S. Dalton, J. M. Trent, Nature Genet. 8, 155 (1994).
-
(1995)
Am. J. Pathol.
, vol.147
, pp. 905
-
-
Isola, J.J.1
-
3
-
-
0028206724
-
-
J. J. Isola et al., Am. J. Pathol. 147, 905 (1995); A. Kallioniemi et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); M. Muleris, A. Almeida, M. Gerbault-Seureau, B. Malfoy, B. Dutrillaux, Genes Chromosomes Cancer 10, 160 (1994); M. M. Tanner et al., Cancer Res. 54, 4257 (1994); X.-Y. Guan, P. S. Meltzer, W. S. Dalton, J. M. Trent, Nature Genet. 8, 155 (1994).
-
(1994)
Proc. Natl. Acad. Sci. U.S.A.
, vol.91
, pp. 2156
-
-
Kallioniemi, A.1
-
4
-
-
0028278457
-
-
J. J. Isola et al., Am. J. Pathol. 147, 905 (1995); A. Kallioniemi et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); M. Muleris, A. Almeida, M. Gerbault-Seureau, B. Malfoy, B. Dutrillaux, Genes Chromosomes Cancer 10, 160 (1994); M. M. Tanner et al., Cancer Res. 54, 4257 (1994); X.-Y. Guan, P. S. Meltzer, W. S. Dalton, J. M. Trent, Nature Genet. 8, 155 (1994).
-
(1994)
Genes Chromosomes Cancer
, vol.10
, pp. 160
-
-
Muleris, M.1
Almeida, A.2
Gerbault-Seureau, M.3
Malfoy, B.4
Dutrillaux, B.5
-
5
-
-
0028064785
-
-
J. J. Isola et al., Am. J. Pathol. 147, 905 (1995); A. Kallioniemi et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); M. Muleris, A. Almeida, M. Gerbault-Seureau, B. Malfoy, B. Dutrillaux, Genes Chromosomes Cancer 10, 160 (1994); M. M. Tanner et al., Cancer Res. 54, 4257 (1994); X.-Y. Guan, P. S. Meltzer, W. S. Dalton, J. M. Trent, Nature Genet. 8, 155 (1994).
-
(1994)
Cancer Res.
, vol.54
, pp. 4257
-
-
Tanner, M.M.1
-
6
-
-
0028001095
-
-
J. J. Isola et al., Am. J. Pathol. 147, 905 (1995); A. Kallioniemi et al., Proc. Natl. Acad. Sci. U.S.A. 91, 2156 (1994); M. Muleris, A. Almeida, M. Gerbault-Seureau, B. Malfoy, B. Dutrillaux, Genes Chromosomes Cancer 10, 160 (1994); M. M. Tanner et al., Cancer Res. 54, 4257 (1994); X.-Y. Guan, P. S. Meltzer, W. S. Dalton, J. M. Trent, Nature Genet. 8, 155 (1994).
-
(1994)
Nature Genet.
, vol.8
, pp. 155
-
-
Guan, X.-Y.1
Meltzer, P.S.2
Dalton, W.S.3
Trent, J.M.4
-
8
-
-
0028846193
-
-
S. A. Onate, S. Y. Tsai, M.-J. Tsai, B. W. O'Malley, Science 270, 1354 (1995).
-
(1995)
Science
, vol.270
, pp. 1354
-
-
Onate, S.A.1
Tsai, S.Y.2
Tsai, M.-J.3
O'Malley, B.W.4
-
9
-
-
0029954339
-
-
J. J. Voegel, M. J. S. Heine, C. Zechel, P. Chambon, H. Gronemeyer, EMBO J. 15, 3667 (1996).
-
(1996)
EMBO J.
, vol.15
, pp. 3667
-
-
Voegel, J.J.1
Heine, M.J.S.2
Zechel, C.3
Chambon, P.4
Gronemeyer, H.5
-
11
-
-
0242587820
-
-
B. Hanstein et al., Proc. Natl. Acad Sci. U.S.A. 93, 11540 (1996); Y. Kamei et al., Cell 85, 403 (1996);
-
(1996)
Cell
, vol.85
, pp. 403
-
-
Kamei, Y.1
-
12
-
-
0029773871
-
-
T.-P. Yao, G. Ku, N. Zhou, R. Scully, D. M. Livingston, Proc. Natl. Acad. Sci. U.S.A. 93, 10626 (1996).
-
(1996)
Proc. Natl. Acad. Sci. U.S.A.
, vol.93
, pp. 10626
-
-
Yao, T.-P.1
Ku, G.2
Zhou, N.3
Scully, R.4
Livingston, D.M.5
-
13
-
-
1842335867
-
-
note
-
32P-labeled polymerase chain reaction (PCR) product amplified from a human spleen cDNA library by using primers designed from the 5′ sequence of pCMVS-PORT-B11, PM-U2 (CCAGAAACGTCACTATCAAG), and BII-IIRA (TTACTGGAACCCCCATACC). Plasmid rescue of 19 positive clones yielded a clone pBluescript-R22, that overlapped pCMVSPORT-B11 and contained the 5′ end of the coding region. To generate a full-length AIB1 clone, we subcloned the 4.85-kb Hind III-Xho I fragment of pCMVSPORT-B11 into the Hind III-Xho I sites of pBluescript-R22. We then subcloned the 4.84-kb Not I-Nhe I fragment of the full-length done containing the entire coding region into the Not I-Xba I sites of the expression vector DCDNA3.1 (Invitrogen) and generated pcDNA3.1-AIB1.
-
-
-
-
14
-
-
0025183708
-
-
S. F. Altschul, W. Gish, W. Miller, E. W. Myers, D. J. Lipman, J. Mol. Biol. 215, 403 (1990).
-
(1990)
J. Mol. Biol.
, vol.215
, pp. 403
-
-
Altschul, S.F.1
Gish, W.2
Miller, W.3
Myers, E.W.4
Lipman, D.J.5
-
15
-
-
0030986236
-
-
D. M. Heery, E. Kalkhoven, S. Hoare, M. G. Parker, Nature 387, 733 (1997).
-
(1997)
Nature
, vol.387
, pp. 733
-
-
Heery, D.M.1
Kalkhoven, E.2
Hoare, S.3
Parker, M.G.4
-
16
-
-
0030912539
-
-
J. Torchia, et al., Nature 387, 677 (1997).
-
(1997)
Nature
, vol.387
, pp. 677
-
-
Torchia, J.1
-
17
-
-
1842329881
-
-
note
-
We obtained established breast cancer cell lines from the American Type Culture Collection (ATCC) (BT474, MCF-7, T-47D, MDA-MB-361, MDA-MB-468, BT-20, MDA-MB-436, and MDA-MB-453), the Arizona Cancer Center (UACC-812), and the National Cancer Institute (ZR75-1). We obtained ovarian cancer cell line BG-1 from Jeff Boyd, University of Pennsylvania. For Northern analysis, we obtained normal human mammary gland total RNA pooled from six individuals between 16 and 35 years old from Clontech. For FISH analysis, interphase nuclei were fixed in methanol and acetic acid (3:1) and dropped onto microscope slides.
-
-
-
-
18
-
-
1842334621
-
-
Data not shown
-
Data not shown.
-
-
-
-
19
-
-
1842369838
-
-
note
-
The BioPrime DNA labeling system (Gibco BRL) was used to label genomic clones containing either AIB1 (3) or the 20q13 amplicon (RMC20C001) (14) with Spectrum Orange deoxyuridine triphosphate (dUTP) (Vysis). We used 20q11 and 20p probes (University of California, Berkeley, Resource for Molecular Cytogenetics RMC20P037 and RMC20P039) as reference probes for two-color FISH analysis after labeling with biotin-16-dUTP (BMB) by nick-translation. FISH followed the method of Pinkel et al. (19) with minor modifications. Fluorescent images were captured with a Zeiss axiophot microscope equipped with a charge-coupled device camera and IP Lab Spectrum software (Signal Analytics). FISH analysis of uncultured breast cancer samples was performed as described (14) from either disaggregated nuclei or sections of ethanol-fixed tumors. Tumors were categorized into three groups according to AIB1 copy number: low (fewer than four copies per cell or no increased relative copy number), moderate (four to six copies per cell or 1.5-to 3-fold relative copy number), and high (more than six copies per cell or >3-fold relative copy number). Only high copy number increases were taken as evidence for gene amplification. In 105 unselected cases, 10 were scored high, 13 were moderate, and 82 were low. ER status was determined by immunohistochemistry for 83 of these specimens including 9 of the 10 cases with AIB1 amplification. Of these nine specimens, four were ER positive and five were ER negative.
-
-
-
-
21
-
-
1842371045
-
-
note
-
33P]t-riphosphate by PCR. We hybridized ethanol-fixed sections from 75 primary breast tumors and six adjacent normal breast tissues as described (20). We knew the ER status for 66 of these samples. AIB1 was highly expressed in 24 of 44 (55%) of the ER-positive cases and in 8 of 22 (36%) of the ER-negative cases.
-
-
-
-
22
-
-
1842377598
-
-
note
-
5 cells per well and allowed them to grow overnight. Transfections were done with calcium phosphate coprecipitation (Clontech) according to the manufacturer's protocol. Transfected DNA included 5 ng of pRL-CMV internal control plasmid, 1.0 μ9 of ER reporter, 250 ng of pHEGO-hyg ER expression vector, the indicated amount of pcDNA3.1-AIB1, or an equivalent amount of pcDNA3. 1 empty vector, and salmon sperm DNA to a total of 7 μg of DNA per dish. After transfection, we incubated cells in the absence or presence of 10 nM 170-estradiol or 100 nM 4-OHT. Cell lysates were harvested and assayed 48 hours after transfection. We determined reporter activities with the dual-luciferase reporter assay system (Promega) and the results are expressed in relative luminescence units (RLU) (luciferase/Renilla luciferase). We obtained pRL-CMV and pGL3-promoter from Promega and pHEGO-hyg from ATCC. ER reporter pGL3.luc.3ERE, which contains three tandem copies of the ERE upstream from the simian virus 40 promoter driving the luaferase gene, was the kind gift of Fern Murdoch, Uniformed Services University of the Health Sciences.
-
-
-
-
23
-
-
1842375816
-
-
note
-
We constructed GST fusion proteins by generating PCR fragments of AIB1 encoding amino acids 1 to 194 and amino acids 605 to 1294 inserted into pGEX 6P-2 (Pharmacia). GST pulldown analysis was done as described by Le Douarin (21) with the following modifications: 6.7 μg of ER (Panvera) was preincubated with or without 2 μM estradiol. Separately, we preincubated 10 μg of either GST, GST-AIB.N1 (containing amino acids 1 to 194), or GST-AIB.T1 (containing amino acids 605 to 1294) with preequilibrated glutathione-Sepharose (Pharmacia) and washed it with binding buffer. ER with or without estradiol mixture was incubated with GST fusion protein-glutathione-Sepharose mixture in binding buffer containing 0.1% bovine serum albumin for 1 hour at room temperature. Glutathione-Sepharose beads were washed five times in binding buffer, and bound proteins were eluted in SDS-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer and separated by SDS-PAGE. Separated proteins were transferred to nylon membranes, incubated sequentially with monoclonal antibody H-151 to ER (Stress-Gen) and horseradish peroxidase containing goat anti-moose immunoglobulin G Fc (Jackson Immunoresearch), and detected by chemiluminescence.
-
-
-
-
24
-
-
0030949836
-
-
H. Hong, K. Kohli, M. J. Garabedian, M. R. Stallcup, Mol. Cell. Biol. 17, 2735 (1997).
-
(1997)
Mol. Cell. Biol.
, vol.17
, pp. 2735
-
-
Hong, H.1
Kohli, K.2
Garabedian, M.J.3
Stallcup, M.R.4
-
27
-
-
0029030016
-
-
B. LeDouarin et al., EMBO J. 14, 2020 (1995).
-
(1995)
EMBO J.
, vol.14
, pp. 2020
-
-
LeDouarin, B.1
-
28
-
-
1842337599
-
-
note
-
Abbreviations for the amino acids are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ite; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
-
-
-
-
29
-
-
1842287536
-
-
note
-
We obtained cDNA clones from Research Genetics [TIF2 (clone 132364, GenBank accession number R25318), SRC-1 (clone 418064, GenBank accession number W90426)], ATCC (pHEGO-hyg, ATCC number 79995), or Clontech (β-actin). The AIB1 probe was a 2.2-kb Not I-Sac I fragment of pCMVS-PORT-B11.
-
-
-
-
30
-
-
0004136246
-
-
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
-
J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
-
(1989)
Molecular Cloning: A Laboratory Manual
-
-
Sambrook, J.1
Fritsch, E.F.2
Maniatis, T.3
-
31
-
-
1842403721
-
-
note
-
The authors gratefully acknowledge the technical assistance of Nasser Parsa and Robin Veldman, Darryl Leja for preparation of the illustrations, and Roger Meisfeld for helpful discussions.
-
-
-
|