메뉴 건너뛰기




Volumn 9, Issue 4, 2007, Pages 671-674

Assessment of 4-nitrogenated benzyloxymethyl groups for 2′-Hydroxyl protection in solid-phase RNA synthesis

Author keywords

[No Author keywords available]

Indexed keywords

BENZYL DERIVATIVE; DYES, REAGENTS, INDICATORS, MARKERS AND BUFFERS; NITRO DERIVATIVE; RNA; THYMIDINE; URIDINE;

EID: 33847772486     PISSN: 15237060     EISSN: None     Source Type: Journal    
DOI: 10.1021/ol0629824     Document Type: Article
Times cited : (30)

References (28)
  • 8
    • 85044900224 scopus 로고    scopus 로고
    • (d) Reese, C. B. Tetrahedon 2002, 58, 8893-8920.
    • (2002) Tetrahedon , vol.58 , pp. 8893-8920
    • Reese, C.B.1
  • 9
    • 33847793391 scopus 로고    scopus 로고
    • Reese, C. B. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; I, pp 2.2.1-2.2.24.
    • (e) Reese, C. B. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; Vol. I, pp 2.2.1-2.2.24.
  • 10
    • 0011801450 scopus 로고    scopus 로고
    • (f) Pitsch, S. Chimia 2001, 55, 320-324.
    • (2001) Chimia , vol.55 , pp. 320-324
    • Pitsch, S.1
  • 13
    • 33847785918 scopus 로고    scopus 로고
    • Miller, T. J.; Schwartz, M. E.; Gough, G. R. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; I, pp 2.5.1-2.5.36 and pp 3.7.1-3.7.8.
    • (b) Miller, T. J.; Schwartz, M. E.; Gough, G. R. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; Vol. I, pp 2.5.1-2.5.36 and pp 3.7.1-3.7.8.
  • 19
    • 33847769512 scopus 로고    scopus 로고
    • Pitsch, S.; Weiss, P. A. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; I, pp 3.8.1-3.8.15.
    • (b) Pitsch, S.; Weiss, P. A. In Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; Vol. I, pp 3.8.1-3.8.15.
  • 22
    • 33847796334 scopus 로고    scopus 로고
    • Experimental details and literature references are reported in the Supporting Information
    • Experimental details and literature references are reported in the Supporting Information.
  • 24
    • 33847774647 scopus 로고    scopus 로고
    • Heating commercial AUCCGUAGCUAAGGUCAUCGU for up to 40 min in 0.1 M AcOH at 90°C did not result in significant chain cleavage as estimated by polyacrylamide gel electrophoresis analysis. Data shown in the Supporting Information.
    • Heating commercial AUCCGUAGCUAAGGUCAUCGU for up to 40 min in 0.1 M AcOH at 90°C did not result in significant chain cleavage as estimated by polyacrylamide gel electrophoresis analysis. Data shown in the Supporting Information.
  • 25
    • 33847776295 scopus 로고    scopus 로고
    • See Chart 1B,C of the Supporting Information.
    • See Chart 1B,C of the Supporting Information.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.