Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line

Science

Volumn 285, Issue 5424, 1999, Pages 110-113

  Lohmann, V ^a   Korner F ^a   Koch, J O ^a   Herian, U ^a   Theilmann, L ^b   Bartenschlager, R ^a  

^a JOHANNES GUTENBERG UNIVERSITY   (Germany)

^b Klinikum Pforzheim GmbH   (Germany)

Author keywords

[No Author keywords available]

Indexed keywords

ANTIVIRUS AGENT; VIRUS PROTEIN; VIRUS RNA;

ANTIVIRAL ACTIVITY; ARTICLE; CELL CULTURE; HEPATITIS C VIRUS; HEPATOMA CELL; ISOTOPE LABELING; LIVER DISEASE; MOLECULAR CLONING; OPEN READING FRAME; PATHOGENESIS; PRIORITY JOURNAL; RELIABILITY; VIRUS REPLICATION;

CARCINOMA, HEPATOCELLULAR; CLONING, MOLECULAR; DRUG RESISTANCE; GENOME, VIRAL; GENTAMICINS; HEPACIVIRUS; HEPATITIS C; HUMANS; LIVER NEOPLASMS; REPLICON; RNA, VIRAL; TRANSFECTION; TUMOR CELLS, CULTURED; VIRAL NONSTRUCTURAL PROTEINS; VIRUS CULTIVATION; VIRUS REPLICATION;

HEPATITIS C VIRUS;

EID: 0345188811     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.285.5424.110     Document Type: Article

References (37)

1. M. Houghton, in Virology, B. N. Fields, D. M. Knipe, P. M. Howley, Eds. (Lippincott-Raven, Philadelphia, PA, 1996), vol. 1, pp. 1035-1058.
2. Q.-L. Choo et al., Science 244, 359 (1989).
3. C. M. Rice, in (1), pp. 931-960; B. Clarke, J. Gen. Virol. 78, 2397 (1997); R. Bartenschlager, Intervirology 40, 378 (1997).
4. C. M. Rice, in (1), pp. 931-960; B. Clarke, J. Gen. Virol. 78, 2397 (1997); R. Bartenschlager, Intervirology 40, 378 (1997).
5. C. M. Rice, in (1), pp. 931-960; B. Clarke, J. Gen. Virol. 78, 2397 (1997); R. Bartenschlager, Intervirology 40, 378 (1997).
6. T. Tanaka, N. Kato, M. J. Cho, K. Shimotohno, Biochem. Biophys. Res. Commun. 215, 744 (1995); T. Tanaka, N. Kato, M. J. Cho, K. Sugiyama, K. Shimotohno, J. Virol. 70, 3307 (1996); A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, ibid., p. 3363; N. Yamada et al., Virology 223, 255 (1996); M. Yanagi, M. S. Claire, S. U. Emerson, R. H. Purcell, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 96, 2291 (1999).
7. T. Tanaka, N. Kato, M. J. Cho, K. Shimotohno, Biochem. Biophys. Res. Commun. 215, 744 (1995); T. Tanaka, N. Kato, M. J. Cho, K. Sugiyama, K. Shimotohno, J. Virol. 70, 3307 (1996); A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, ibid., p. 3363; N. Yamada et al., Virology 223, 255 (1996); M. Yanagi, M. S. Claire, S. U. Emerson, R. H. Purcell, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 96, 2291 (1999).
8. T. Tanaka, N. Kato, M. J. Cho, K. Shimotohno, Biochem. Biophys. Res. Commun. 215, 744 (1995); T. Tanaka, N. Kato, M. J. Cho, K. Sugiyama, K. Shimotohno, J. Virol. 70, 3307 (1996); A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, ibid., p. 3363; N. Yamada et al., Virology 223, 255 (1996); M. Yanagi, M. S. Claire, S. U. Emerson, R. H. Purcell, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 96, 2291 (1999).
9. T. Tanaka, N. Kato, M. J. Cho, K. Shimotohno, Biochem. Biophys. Res. Commun. 215, 744 (1995); T. Tanaka, N. Kato, M. J. Cho, K. Sugiyama, K. Shimotohno, J. Virol. 70, 3307 (1996); A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, ibid., p. 3363; N. Yamada et al., Virology 223, 255 (1996); M. Yanagi, M. S. Claire, S. U. Emerson, R. H. Purcell, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 96, 2291 (1999).
10. T. Tanaka, N. Kato, M. J. Cho, K. Shimotohno, Biochem. Biophys. Res. Commun. 215, 744 (1995); T. Tanaka, N. Kato, M. J. Cho, K. Sugiyama, K. Shimotohno, J. Virol. 70, 3307 (1996); A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, ibid., p. 3363; N. Yamada et al., Virology 223, 255 (1996); M. Yanagi, M. S. Claire, S. U. Emerson, R. H. Purcell, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 96, 2291 (1999).
11. A. A. Kolykhalov et al., Science 277, 570 (1998); M. Yanagi, R. H. Purcell, S. U. Emerson, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 94, 8738 (1997); M. Yanagi et al., Virology 244, 161 (1998).
12. A. A. Kolykhalov et al., Science 277, 570 (1998); M. Yanagi, R. H. Purcell, S. U. Emerson, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 94, 8738 (1997); M. Yanagi et al., Virology 244, 161 (1998).
13. A. A. Kolykhalov et al., Science 277, 570 (1998); M. Yanagi, R. H. Purcell, S. U. Emerson, J. Bukh, Proc. Natl. Acad. Sci. U.S.A. 94, 8738 (1997); M. Yanagi et al., Virology 244, 161 (1998).
14. R. E. Lanford, C. Sureau, J. R. Jacob, R. White, T. R. Fuerst, Virology 202, 606 (1994); Y. K. Shimizu, A. Iwamoto, M. Hijikata, R. H. Purcell, H. Yoshikura, Proc. Natl. Acad. Sci. U.S.A. 89, 5477 (1992); T. Mizutani et al., J. Virol. 70, 7219 (1996); M. Ikeda et al., Virus Res. 56, 157 (1998); C. Fournier et al., J. Gen. Virol. 79, 2376 (1998).
15. R. E. Lanford, C. Sureau, J. R. Jacob, R. White, T. R. Fuerst, Virology 202, 606 (1994); Y. K. Shimizu, A. Iwamoto, M. Hijikata, R. H. Purcell, H. Yoshikura, Proc. Natl. Acad. Sci. U.S.A. 89, 5477 (1992); T. Mizutani et al., J. Virol. 70, 7219 (1996); M. Ikeda et al., Virus Res. 56, 157 (1998); C. Fournier et al., J. Gen. Virol. 79, 2376 (1998).
16. R. E. Lanford, C. Sureau, J. R. Jacob, R. White, T. R. Fuerst, Virology 202, 606 (1994); Y. K. Shimizu, A. Iwamoto, M. Hijikata, R. H. Purcell, H. Yoshikura, Proc. Natl. Acad. Sci. U.S.A. 89, 5477 (1992); T. Mizutani et al., J. Virol. 70, 7219 (1996); M. Ikeda et al., Virus Res. 56, 157 (1998); C. Fournier et al., J. Gen. Virol. 79, 2376 (1998).
17. R. E. Lanford, C. Sureau, J. R. Jacob, R. White, T. R. Fuerst, Virology 202, 606 (1994); Y. K. Shimizu, A. Iwamoto, M. Hijikata, R. H. Purcell, H. Yoshikura, Proc. Natl. Acad. Sci. U.S.A. 89, 5477 (1992); T. Mizutani et al., J. Virol. 70, 7219 (1996); M. Ikeda et al., Virus Res. 56, 157 (1998); C. Fournier et al., J. Gen. Virol. 79, 2376 (1998).
18. R. E. Lanford, C. Sureau, J. R. Jacob, R. White, T. R. Fuerst, Virology 202, 606 (1994); Y. K. Shimizu, A. Iwamoto, M. Hijikata, R. H. Purcell, H. Yoshikura, Proc. Natl. Acad. Sci. U.S.A. 89, 5477 (1992); T. Mizutani et al., J. Virol. 70, 7219 (1996); M. Ikeda et al., Virus Res. 56, 157 (1998); C. Fournier et al., J. Gen. Virol. 79, 2376 (1998).
19. Total RNA was isolated from explanted liver (∼100 mg) (20), and 1 μg was used for reverse transcription with primers A6103 (GCTATGAGCCGGTTCATCCACTGC) or A9413 (CAGGATGGCCTATTGGCCTGGAG) and the Expand Reverse Transcriptase System (Boehringer Mannheim, Germany). PCR was performed with the Expand Long Template System (Boehringer Mannheim) in buffer containing 2% dimethylsulfoxide. After 1 hour at 42°C, one-eighth of the mixture was used for the first PCR with primers A6103 and SS9 (TGTCTTCACGCAGAAAGCGTCTAG) or A9413 and S4542 (GATGAGCTCGCCGCGAAGCTGTCC). After 40 cycles, one-tenth was used for the second PCR with primers S59 and A4919 (AGCACAGCCCGCGTCATAGCACTCG) or S4542 and A9386 (TTAGCTCCCCGTTCATCGGTTCG). After 30 cycles, the PCR products were purified by preparative agarose gel electrophoresis, and eluted fragments were ligated into vector pCR2.1 (Invitragen) or pBSK II (Stratagene). Four clones of each fragment were analyzed and a consensus sequence was established. To resolve ambiguities, we amplified shorter PCR fragments covering the corresponding region and sequenced multiple clones. The 3′ NTR was obtained by conventional PCR with an antisense primer covering the last 24 nt of the genome (4). The authentic 5′ NTR downstream of the T7 promoter was generated by PCR with an oligonucleotide corresponding to a truncated T7 promoter (TAATACGACTCACTATAG) and the first 88 nt of HCV and a plasmid carrying one of the 5′ fragments of the genome. The complete genome was assembled from subgenomic fragments carrying the least numbers of nonconsensus nucleotide changes and inserted into a modified pBR322 vector. Nonconsensus changes were removed by site-directed mutagenesis. To generate run-off transcripts with an authentic 3′ end, we modified the 3′ NTR of our isolate (terminating with TGT) to match the sequence of genotype 3 [clone WS; A. A. Kolykhalov, S. M. Feinstone, C. M. Rice, J. Virol. 70, 3363 (1996)] terminating with ACT, which allowed us to introduce a recognition sequence for the restriction enzyme Sca I (AGTACT) at the end of the 3′ NTR. A guanine was replaced with an adenine nucleotide at position 8180 of the genome to remove an internal Sea I site. After assembly of the full-length genome with appropriate 5′ and 3′ NTRs, the complete HCV sequence [European Molecular Biology Laboratory (EMBL) accession number AJ238799] was verified.
20. 2, 2 mM spermidine, 40 mM dithiothreitol, 2 mM of each nucleoside triphosphate, RNasin (1 U/ml), DNA template (50 μg/ml), and T7 RNA polymerase (∼2 U/μl). To increase the yields, after 2 hours at 37°C an extra 1 U of T7 RNA polymerase was added per microliter, and the reaction was incubated for an additional 2 hours. DNA was removed by extraction with acid phenol [W. Kedzierski and J. C. Porter, BioTechniques 10, 210 (1991)] and treatment with 2 U of deoxyribonuclease (DNase) per microgram of DNA for 60 min at 37°C. RNA was purified and analyzed by denaturing agarose gel electrophoresis.
21. Purified in vitro transcripts corresponding to the parental or the inactivated HCV genome were used for transfection of human hepatoma cell lines and primary human hepatocytes. Cell lines were maintained in a medium as described [B. J. Yoo et al., J. Virol. 69, 32 (1995)] and passaged once a week. Total RNA was prepared from transfected cells, and serial dilutions were used for RT-PCR amplification of the 5′ NTR or an NSSB sequence covering the 10-amino acid deletion. This allowed discrimination between the parental and the inactivated genome carrying the in-frame deletion. We monitored RNA replication by comparing the amounts of HCV RNA found in cells transfected with the wild-type or the inactivated genome. Input RNA was detected for up to three passages, with similar amounts seen for both genomes.
22. A. A. Khromykh and E. G. Westaway, J. Virol. 71, 1497 (1997).
23. S.-E. Behrens, C. W. Grassmann, H.-J. Thiel, G. Meyers, N. Tautz, ibid. 72, 2364 (1998).
24. 389/NS3-3′).
25. 389/NS3-3′).
26. After in vitro transcription and DNase treatment (8), RNA was extracted with acid phenol, acid phenolchloroform, and chloroform and analyzed by formaldehyde agarose gel electrophoresis.
27. H. Nakabayashi, K. Taketa, K. Miyano, T. Yamane, J. Sato, Cancer Res. 42, 3858 (1982).
28. 6 Huh-7 cells, which were then seeded into a 10-cm-diameter dish. After 24 hours, G418 was added to 1 mg/ml, and the medium was changed twice per week. Small colonies appeared after 3 to 5 weeks and were isolated and passaged under the same conditions.
29. S.-E. Behrens, L. Tomei, R. De Francesco, EMBO J. 15, 12 (1996); V. Lohmann, F. Körner, U. Herian, R. Bartenschlager, J. Virol. 71, 8416 (1997).
30. S.-E. Behrens, L. Tomei, R. De Francesco, EMBO J. 15, 12 (1996); V. Lohmann, F. Körner, U. Herian, R. Bartenschlager, J. Virol. 71, 8416 (1997).
31. Y. Gong et al., J. Gen. Virol. 77, 2729 (1996).
32. As will be reported elsewhere (V. Lohmann and R. Bartenschlager, in preparation), we recloned HCV replicons from 1 μg of total RNA by RT-PCR using primers S59 and A9413 (7). For amplification of 5′ and 3′ NTRs, we used an RNA ligation approach before PCR, Among 10 sequenced replicons, no converging mutations were found. Each replicon contained 6 to 12 amino acid substitutions scattered throughout the HCV ORF. The NTRs were highly conserved, and only sporadic nucleotide changes were observed.
33. HCV RNA contained in total RNA of cell clones 5-15 and 9-13 was quantified by Northern blot, and 20 μg of total RNA were used for transfection (15). An equivalent number of in vitro-transcribed replicon molecules was supplemented with total RNA from naïve Huh-7 cells to the same concentration and transfected in parallel Cotransfection of a construct directing the expression of firefly luciferase was used to correct for transfection efficiency. No significant difference in the number of G418-resistant colonies was found between total RNA isolated from the two cell clones and the in vitro RNA mixture.
34. P. Chomczynski and N. Sacchi, Anal. Biochem. 162, 156 (1987).
35. R. Bartenschlager, V. Lohmann, T. Wilkinson, J. O. Koch, J. Virol. 69, 7519 (1995).
36. T. R. Fuerst, E. G. Niles, F. W. Studier, B. Moss, Proc. Natl. Acad. Sci. U.S.A. 83, 8122 (1986).
37. We thank R. Devos and H. Schaller for critical reading of the manuscript and stimulating discussions; P. Hahn, K. Rispeter, and P. Hilgert for technical assistance; B. Moss for vaccinia virus vTF7-3; M. Billeter for plasmid encoding T7 RNA polymerase; and M. J. Reddehase for continuous support and critical reading of the manuscript. Supported by grants from Roche Products, the German Ministry for Research and Technology (01 KI 9653/9), and the German Research Society (Ba 1505/1-2).