메뉴 건너뛰기




Volumn 283, Issue 5403, 1999, Pages 848-849

CD3- and CD28-dependent induction of PDE7 required for T cell activation

Author keywords

[No Author keywords available]

Indexed keywords

CD28 ANTIGEN; CD3 ANTIGEN; CYCLIC AMP; INTERLEUKIN 2; PHOSPHODIESTERASE;

EID: 0033524977     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.283.5403.848     Document Type: Article
Times cited : (240)

References (29)
  • 2
  • 5
    • 0028328869 scopus 로고
    • B. S. Skalhegg et al., Science 263, 84 (1994); D. Laxminarayana and C. M. Kammer, J. Immunol. 156, 497 (1996).
    • (1994) Science , vol.263 , pp. 84
    • Skalhegg, B.S.1
  • 7
    • 0030963439 scopus 로고    scopus 로고
    • M. R. Vossler et al., Cell 89, 73 (1997).
    • (1997) Cell , vol.89 , pp. 73
    • Vossler, M.R.1
  • 8
    • 0025667152 scopus 로고
    • T. J. Novak and E. V. Rothenberg, Proc. Natl. Acad. Sci. U.S.A. 87, 9353 (1990); Y. P. Hsueh and M. Z. Lai, J. Biol. Chem. 270, 18094 (1995); A. Tamir, Y. Granot, N. Isakov, J. Immunol. 157, 1514 (1996); E. M. Aandahl et al., FASEB J. 12, 855 (1998).
    • (1990) Proc. Natl. Acad. Sci. U.s.a. , vol.87 , pp. 9353
    • Novak, T.J.1    Rothenberg, E.V.2
  • 9
    • 0029050265 scopus 로고
    • T. J. Novak and E. V. Rothenberg, Proc. Natl. Acad. Sci. U.S.A. 87, 9353 (1990); Y. P. Hsueh and M. Z. Lai, J. Biol. Chem. 270, 18094 (1995); A. Tamir, Y. Granot, N. Isakov, J. Immunol. 157, 1514 (1996); E. M. Aandahl et al., FASEB J. 12, 855 (1998).
    • (1995) J. Biol. Chem. , vol.270 , pp. 18094
    • Hsueh, Y.P.1    Lai, M.Z.2
  • 10
    • 0030586676 scopus 로고    scopus 로고
    • T. J. Novak and E. V. Rothenberg, Proc. Natl. Acad. Sci. U.S.A. 87, 9353 (1990); Y. P. Hsueh and M. Z. Lai, J. Biol. Chem. 270, 18094 (1995); A. Tamir, Y. Granot, N. Isakov, J. Immunol. 157, 1514 (1996); E. M. Aandahl et al., FASEB J. 12, 855 (1998).
    • (1996) J. Immunol. , vol.157 , pp. 1514
    • Tamir, A.1    Granot, Y.2    Isakov, N.3
  • 11
    • 0031748984 scopus 로고    scopus 로고
    • T. J. Novak and E. V. Rothenberg, Proc. Natl. Acad. Sci. U.S.A. 87, 9353 (1990); Y. P. Hsueh and M. Z. Lai, J. Biol. Chem. 270, 18094 (1995); A. Tamir, Y. Granot, N. Isakov, J. Immunol. 157, 1514 (1996); E. M. Aandahl et al., FASEB J. 12, 855 (1998).
    • (1998) FASEB J. , vol.12 , pp. 855
    • Aandahl, E.M.1
  • 12
    • 0029016332 scopus 로고
    • L. Tsuruta et al., J. Immunol. 154, 5255 (1995); C. R. Beals, C. M. Sheridan, C. W. Turck, P. Gardner, G. R. Crabtree, Science 275, 1930 (1997); C. M. Sheridan and P. Gardner, paper presented at the Gordon Research Conferences, Kimball Union, NH, 7 June 1998.
    • (1995) J. Immunol. , vol.154 , pp. 5255
    • Tsuruta, L.1
  • 13
    • 0030890234 scopus 로고    scopus 로고
    • L. Tsuruta et al., J. Immunol. 154, 5255 (1995); C. R. Beals, C. M. Sheridan, C. W. Turck, P. Gardner, G. R. Crabtree, Science 275, 1930 (1997); C. M. Sheridan and P. Gardner, paper presented at the Gordon Research Conferences, Kimball Union, NH, 7 June 1998.
    • (1997) Science , vol.275 , pp. 1930
    • Beals, C.R.1    Sheridan, C.M.2    Turck, C.W.3    Gardner, P.4    Crabtree, G.R.5
  • 14
    • 85177003047 scopus 로고    scopus 로고
    • Kimball Union, NH, 7 June
    • L. Tsuruta et al., J. Immunol. 154, 5255 (1995); C. R. Beals, C. M. Sheridan, C. W. Turck, P. Gardner, G. R. Crabtree, Science 275, 1930 (1997); C. M. Sheridan and P. Gardner, paper presented at the Gordon Research Conferences, Kimball Union, NH, 7 June 1998.
    • (1998) Gordon Research Conferences
    • Sheridan, C.M.1    Gardner, P.2
  • 15
    • 0027723386 scopus 로고    scopus 로고
    • J. Marx, Science 262, 988 (1993); J. Wu et al., ibid., p. 1065; H. Mischak et al., Mol. Cell Biol. 16, 5409 (1996); A. B. Sprenkle, S. P. Davies, D. Carling, D. G. Hardie, T. W. Sturgill, FEBS Lett. 403, 254 (1997).
    • (1993) Science , vol.262 , pp. 988
    • Marx, J.1
  • 16
    • 0027723386 scopus 로고    scopus 로고
    • J. Marx, Science 262, 988 (1993); J. Wu et al., ibid., p. 1065; H. Mischak et al., Mol. Cell Biol. 16, 5409 (1996); A. B. Sprenkle, S. P. Davies, D. Carling, D. G. Hardie, T. W. Sturgill, FEBS Lett. 403, 254 (1997).
    • Science , pp. 1065
    • J, W.1
  • 17
    • 0029810302 scopus 로고    scopus 로고
    • J. Marx, Science 262, 988 (1993); J. Wu et al., ibid., p. 1065; H. Mischak et al., Mol. Cell Biol. 16, 5409 (1996); A. B. Sprenkle, S. P. Davies, D. Carling, D. G. Hardie, T. W. Sturgill, FEBS Lett. 403, 254 (1997).
    • (1996) Mol. Cell Biol. , vol.16 , pp. 5409
    • Mischak, H.1
  • 21
  • 22
    • 0025799591 scopus 로고
    • S. A. Robicsek et al., Biochem. Pharmacol. 42, 869 (1991); M. A. Giembycz, C. J. Corrigan, J. Seybold, R. Newton, P. J. Barnes, Br. J. Pharmacol. 118, 1945 (1996).
    • (1991) Biochem. Pharmacol. , vol.42 , pp. 869
    • Robicsek, S.A.1
  • 25
    • 0027164208 scopus 로고
    • T. Michaeli et al., ibid. 268, 12925 (1993); P. Han, X. Zhu, T. Michaeli, ibid. 272, 16152 (1997).
    • (1993) J. Biol. Chem. , vol.268 , pp. 12925
    • Michaeli, T.1
  • 27
    • 0344831145 scopus 로고    scopus 로고
    • note
    • 3H]thymidine was then added per well. Sixteen hours later, cells were harvested for scintillation counting.
  • 28
    • 0345262488 scopus 로고    scopus 로고
    • note
    • The three PDE7 antisense oligonucleotides were as follows: from position 1 to 24 (AS-0: 5′-CGGCAGCT-GCTAACACACTTCCAT); from position 708 to 728 (AS-708: 5′-CAGTGCATGGCCTGAGTAAC); and from position 937 to 959 (AS-959: 5′-GGCAGATGT-GAGAATAAGCCTG). For RT-PCR analysis, PDE7-specific primer pairs were as follows: 5′-GATATTTGTA-ACCCATGTCGGACG-3′ and 5′-AAAGCTTGGCGG-TACTCTATCGAT-3′. PDE4A-specific primer pairs were as follows: AAGAGGAGGAAGAAATATCAATGG and TTACAGCAACCACGAATTCCTCC.
  • 29
    • 0345262487 scopus 로고    scopus 로고
    • note
    • We thank L. H. Li for help with RT-PCR analysis and D. Stenger for comments on the manuscript. This research is supported by NIH grant DK21723 to J.A.B. and by a grant from the Ono Pharmaceutical Company. C.Y. is the recipient of a Career Award from the Burroughs Wellcome Fund.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.