Independent and epigenetic regulation of the interleukin-4 alleles in CD4+ T cells

Science

Volumn 281, Issue 5381, 1998, Pages 1352-1354

  Bix, Mark ^a   Locksley, Richard M ^a  

^a UNIVERSITY OF CALIFORNIA   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

CD4 ANTIGEN; CYTOKINE; INTERLEUKIN 4;

ALLELE; ANIMAL CELL; ARTICLE; CONTROLLED STUDY; EXON; GENE EXPRESSION REGULATION; HELPER CELL; MOUSE; NONHUMAN; PRIORITY JOURNAL; PROTEIN EXPRESSION; STEM CELL;

ANIMALIA;

EID: 0032575727     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.281.5381.1352     Document Type: Article

References (25)

1. A. K. Abbas, K. M. Murphy, A. Sher, Nature 383, 787 (1996).
2. A. Kelso and N. M. Gough, Proc. Natl. Acad. Sci. U.S.A. 85, 9189 (1988); R. P. Bucy et al., J. Exp. Med. 180, 1251 (1994); M. Assenmacher, J. Schmitz, A. Radbruch, Eur. J. Immunol. 24, 1097 (1994); A. Kelso, P. Groves, A. B. Troutt, K. Francis, ibid. 25, 1168 (1995).
3. A. Kelso and N. M. Gough, Proc. Natl. Acad. Sci. U.S.A. 85, 9189 (1988); R. P. Bucy et al., J. Exp. Med. 180, 1251 (1994); M. Assenmacher, J. Schmitz, A. Radbruch, Eur. J. Immunol. 24, 1097 (1994); A. Kelso, P. Groves, A. B. Troutt, K. Francis, ibid. 25, 1168 (1995).
4. A. Kelso and N. M. Gough, Proc. Natl. Acad. Sci. U.S.A. 85, 9189 (1988); R. P. Bucy et al., J. Exp. Med. 180, 1251 (1994); M. Assenmacher, J. Schmitz, A. Radbruch, Eur. J. Immunol. 24, 1097 (1994); A. Kelso, P. Groves, A. B. Troutt, K. Francis, ibid. 25, 1168 (1995).
5. A. Kelso and N. M. Gough, Proc. Natl. Acad. Sci. U.S.A. 85, 9189 (1988); R. P. Bucy et al., J. Exp. Med. 180, 1251 (1994); M. Assenmacher, J. Schmitz, A. Radbruch, Eur. J. Immunol. 24, 1097 (1994); A. Kelso, P. Groves, A. B. Troutt, K. Francis, ibid. 25, 1168 (1995).
6. R. P. Bucy et al., Proc. Natl. Acad. Sci. U.S.A. 92, 7565 (1995).
7. Cellular RNA was isolated through use of RNAzol-B (Biotecx, Houston, TX). cDNA was prepared with a kit from Clontech Laboratories (Palo Alto, CA). PCR primers spanned the first intron of the IL-4 gene to avoid contributions by DNA contamination. PCR was done with a primer from exon 1 (ACTTAATTGTCTCTCGTCACT) together with a primer from exon 2 (ACGTTTGGCACATCCATCTCC) or a nested primer that spanned the exon 1-exon 2 splice junction (CATGGCGTCCCTTCTCCTGT). The first-round PCR reaction (one cycle; 94°C for 2 min, 56°C for 4 min, 72°C for 2 min; 38 cycles: 94°C for 1 min, 56°C for 1 min, 72°C for 2 min) with exon 1 and exon 2 primers yielded a 203-base pair (bp) product. The second-round reaction (one cycle: 94°C for 2 min; 30 cycles: 94°C for 1 min, 56°C for 1 min, 72°C for 2 min) with exon 1 and the nested primer yielded a product 26 bp smaller. Sequence analysis of the IL-4 gene revealed a polymorphism in exon 1 that allowed discrimination of 129 and BALB/c from CAST/Ei strain cDNA by differential sensitivity to Bsg I endonuclease. CAST/Ei PCR products were sensitive to Bsg I, liberating two restriction fragments of 9 and 194 bp (and for nested reactions, 9 and 168 bp). PCR products from all strains were sensitive to Sau 3AI, liberating two restriction fragments of 134 and 69 bp (for nested reactions, 134 and 43 bp). Restriction fragments were resolved through 3.5% Metaphor agarose (FMC BioProducts, Rockland, ME) in 1× tris-borate-EDTA buffer.
8. 1 T cells were recovered by purification over Ficoll.
9. 1 cells were distributed in five serial, 10-fold dilutions in which the total cell number of each dilution was normalized by the addition of thymocytes from IL-4 gene-knockout mice (18). IL-4 null thymocytes did not generate a signal in these assays and thus served to normalize the conditions. From each dilution, 100 samples, each containing 1000 cells, were frozen for later analysis. Ten aliquots from each of the five dilutions were then sampled for the presence of IL-4 mRNA. RNA isolated from each aliquot was used to make cDNA, from which a sensitive semi-nested IL-4 PCR reaction was performed (Fig. 1A). A dilution that yielded a frequency of one positive IL-4 PCR signal out of 10 sampled aliquots was chosen for further analysis, because positive aliquots from such a dilution were unlikely to result from the RNA of two or more distinct, IL-4 - producing cells. Calculation of the estimated numbers of IL-4 - expressing cells in the starting population yielded a frequency of 3.6%, in agreement with previous studies (3). The remaining 90 aliquots from each positive dilution were then processed into cDNA and analyzed for IL-4 expression by semi-nested PCR, followed by Bsg I digestion to discern the parental source of the transcripts, and, as a control, with Sau 3AI, which recognizes the products of both alleles.
10. A. Chess, I. Simon, H. Cedar, R. Axel, Cell 78, 823 (1994).
11. J. V. Melo, X. H. Yan, J. Diamond, F. Lin, N. C. Cross, J. M. Goldman, Leukemia 10, 1217 (1996).
12. M. Bix and R. Locksley; unpublished data.
13. d+ cells were distributed by flow cytometry (Becton Dickinson Vantage, Mountain View, CA) as single cells (series A or B) or by limiting dilution (series C) into 96-well plates containing irradiated T cell-depleted C57BL/6 spleen cells, IL-4, and IL-2. Clones were picked 16 to 37 days after plating. Cloning efficiency ranged from 0.4 to 3%.
14. 5 cells were activated for 17 hours by culture on plates coated with mAbs to TCRβ (H57-597, 10 μg/ml) and CD28 (37N51.1, 10 μg/ml) before harvesting for RNA.
15. DNA was prepared from clones by standard methods and used to template primers that distinguish sequence length polymorphisms between BALB/c and CAST/Ei at positions D11Mit20, D11Mit271, and D11Mit242 flanking the IL-4 gene on chromosome 11.
16. A. Chess, Science 279, 2067 (1998).
17. W. Held, J. Roland, D. H. Raulet, Nature 376, 355 (1995).
18. C. A. Holländer et al., Science 279, 2118 (1998).
19. W. Held and D. H. Raulet, Eur. J. Immunol. 27, 2876 (1997).
20. H. Wu, X. Liu, R. Jaenisch, H. F. Lodish, Cell 83, 59 (1995); M. A. Cross and T. Enver, Curr. Opin. Genet. Dev. 7, 609 (1997); D. Kioussis and R. Festenstein, in Molecular Biology of B-Cell and T-Cell Development, J. G. Monroe and E. V. Rothenberg, Eds. (Humana, Totowa, NJ, 1998), pp. 31-50.
21. H. Wu, X. Liu, R. Jaenisch, H. F. Lodish, Cell 83, 59 (1995); M. A. Cross and T. Enver, Curr. Opin. Genet. Dev. 7, 609 (1997); D. Kioussis and R. Festenstein, in Molecular Biology of B-Cell and T-Cell Development, J. G. Monroe and E. V. Rothenberg, Eds. (Humana, Totowa, NJ, 1998), pp. 31-50.
22. H. Wu, X. Liu, R. Jaenisch, H. F. Lodish, Cell 83, 59 (1995); M. A. Cross and T. Enver, Curr. Opin. Genet. Dev. 7, 609 (1997); D. Kioussis and R. Festenstein, in Molecular Biology of B-Cell and T-Cell Development, J. G. Monroe and E. V. Rothenberg, Eds. (Humana, Totowa, NJ, 1998), pp. 31-50.
23. R. Kuhn, K. Rajewsky, W. Muller, Science 254, 707 (1991).
24. M. Zijlstra et al., Nature 344, 742 (1990).
25. 1 mice; R. Coffman, G. Trinchieri, and J. Allison for reagents; E. Weider for assistance with flow cytometry; and D. Raulet and N. Killeen for critical reading of the manuscript. Animals were cared for in accordance with institutional guidelines. Supported by NIH grants AI26918 and HL56385, Irvington Institute, and Burroughs Wellcome.