메뉴 건너뛰기




Volumn 279, Issue 5359, 1998, Pages 2118-2121

Monoallelic expression of the interleukin-2 locus

Author keywords

[No Author keywords available]

Indexed keywords

INTERLEUKIN 2;

EID: 7144256245     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.279.5359.2118     Document Type: Article
Times cited : (210)

References (61)
  • 1
    • 0023907493 scopus 로고
    • K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
    • (1988) Science , vol.240 , pp. 1169
    • Smith, K.A.1
  • 2
    • 0022557578 scopus 로고
    • K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
    • (1986) Immunol. Rev. , vol.92 , pp. 121
    • Taniguchi, T.1
  • 3
    • 0024516721 scopus 로고
    • K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
    • (1989) Science , vol.243 , pp. 781
    • Tigges, M.A.1    Casey, L.S.2    Koshland, M.E.3
  • 4
    • 0026710448 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1992) Clin. Exp. Immunol. , vol.89 , pp. 204
    • Rump, J.A.1
  • 5
    • 0026478572 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1992) J. Pediatr. , vol.121 , pp. 873
    • Sorensen, R.U.1    Boehm, K.D.2    Kaplan, D.3    Berger, M.4
  • 6
    • 0026710448 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1989) Proc. Natl. Acad. Sci. U.S.A. , vol.86 , pp. 5069
    • Pawha, R.1
  • 7
    • 0024565744 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1989) N. Engl. J. Med. , vol.320 , pp. 696
    • Chatila, T.1
  • 8
    • 0025297840 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1990) N. Engl. J. Med. , vol.322 , pp. 1718
    • Weinberg, K.1    Parkman, R.2
  • 9
    • 0025289836 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1990) J. Exp. Med. , vol.171 , pp. 1697
    • Di-Santo, J.P.1    Keever, C.A.2    Small, T.N.3    Nichols, G.L.4    O'Reilly, R.J.5
  • 10
    • 0020063538 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1982) J. Immunol. , vol.128 , pp. 679
    • Lopez-Botet, M.1    Fontan, G.2    Garcia Rodriquez, M.C.3    De Landazuri, M.O.4
  • 11
    • 0020693418 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1983) Clin. Exp. Immunol. , vol.51 , pp. 338
    • Paganelli, R.1    Aiuti, F.2    Beverly, P.C.L.3    Levinsky, R.J.4
  • 12
    • 0023488504 scopus 로고
    • J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
    • (1987) Clin. Immunol. Immunopathol. , vol.45 , pp. 471
    • Ohno, T.1
  • 14
    • 0025855211 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1991) J. Exp. Med. , vol.173 , pp. 1323
    • Andreu-Sanchez, J.L.1
  • 15
    • 0026474396 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1992) Eur. J. Immunol. , vol.22 , pp. 2867
    • Gutierrez-Ramos, J.C.1    Moreno De Alboran, I.2    Martinez-A., C.3
  • 16
    • 0026871005 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1992) Semin. Immunol. , vol.4 , pp. 167
    • Kroemer, G.1    Martinez-A., C.2
  • 17
    • 0023914792 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1988) Immunology , vol.64 , pp. 413
    • Essery, G.1    Feldmann, M.2    Lamb, J.R.3
  • 18
    • 0025791940 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1991) J. Immunol. , vol.147 , pp. 3261
    • Desilva, D.R.1    Urdahl, K.B.2    Jenkins, M.K.3
  • 19
    • 0000778129 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1985) Proc. Natl. Acad. Sci. U.S.A. , vol.82 , pp. 536
    • Malkowsky, M.1
  • 20
    • 0023181427 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1987) Transplantation , vol.43 , pp. 523
    • Niederkorn, N.Y.1
  • 21
    • 0028215558 scopus 로고
    • J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
    • (1994) Blood , vol.83 , pp. 2560
    • Sykes, M.1    Harty, M.W.2    Szot, G.L.3    Pearson, D.A.4
  • 22
    • 0028181498 scopus 로고    scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • (1994) Immunol. Today , vol.15 , pp. 225
    • Rudd, C.A.1
  • 23
    • 0028181498 scopus 로고    scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • Immunol. Today , pp. 321
    • June, C.H.1    Bluestone, J.A.2    Nadler, L.M.3    Thompson, C.B.4
  • 24
    • 0028278268 scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • (1994) Curr. Opin. Immunol. , vol.6 , pp. 385
    • Collins, T.A.1    Kassner, P.D.2    Bierer, B.E.3    Burakoff, S.J.4
  • 25
    • 0027403299 scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • (1993) Annu. Rev. Immunol. , vol.11 , pp. 191
    • Linsley, P.S.1    Ledbetter, J.A.2
  • 26
    • 0028288927 scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • (1994) Annu. Rev. Immunol. , vol.12 , pp. 555
    • Chan, A.C.1    Desai, D.M.2    Weiss, A.3
  • 27
    • 0028501442 scopus 로고
    • C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
    • (1994) Immunity , vol.1 , pp. 443
    • Jenkins, M.K.1
  • 28
    • 0025255387 scopus 로고
    • K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
    • (1990) Annu. Rev. Immunol. , vol.8 , pp. 421
    • Ullman, K.1    Northrop, J.P.2    Verweij, C.L.3    Crabtree, J.R.4
  • 29
    • 0028300431 scopus 로고
    • K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
    • (1994) Immunol. Today , vol.15 , pp. 274
    • Rao, A.1
  • 30
    • 0025351406 scopus 로고
    • K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
    • (1990) Immunol. Today , vol.11 , pp. 211
    • June, C.H.1    Ledbetter, J.A.2    Linsley, P.S.3    Thompson, C.B.4
  • 31
    • 0028329603 scopus 로고
    • K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
    • (1994) Moll. Cell. Biol. , vol.14 , pp. 2159
    • Garrity, P.A.1    Chen, D.2    Rothenberg, E.V.3    Wold, B.J.4
  • 32
    • 7144262064 scopus 로고    scopus 로고
    • note
    • - thymocytes stained for IL-2 further emphasizes the lack of a developmental advantage for thymocytes that produce IL-2.
  • 33
    • 7144255873 scopus 로고    scopus 로고
    • note
    • + T cells but treated identically as outlined above served as negative controls, whereas the simultaneous addition of IL-2 and CTLL-20 cells served as the positive control. This measurement of IL-2 corrsponds to a modified method of (25).
  • 34
    • 7144262760 scopus 로고    scopus 로고
    • G. A. Holländer, K. Mobisson, S. J. Burakoff, unpublished results
    • G. A. Holländer, K. Mobisson, S. J. Burakoff, unpublished results.
  • 37
    • 7144250217 scopus 로고    scopus 로고
    • note
    • Fixed and rehydrated cytocentrifuged smears were stained with biotinylated mAb to IL-2 (JES6-5H4) followed by avidin-coupled fluorescein isothiocyanate (FITC) (Becton Dickinson). Single cells were scanned by ACAS interactive laser cytometry, and ACAS software (Meridian Instruments) was used to analyze the fluorescence scans.
  • 39
    • 0029811865 scopus 로고    scopus 로고
    • F. Matesanz and A. Alcina, Eur. J. Immunol. 26, 1675 (1996); _ and A. Pellicer, Immunogenetics 38, 300 (1993).
    • (1993) Immunogenetics , vol.38 , pp. 300
    • Pellicer, A.1
  • 40
    • 7144254124 scopus 로고    scopus 로고
    • note
    • + T cells were then sorted by flow cytometry as single cells into 10 μl of 2× reverse transcription (RT) buffer containing 0.05% NP-40 and immediately frozen on dry ice. RT was done on single-cell lysates or fractions thereof with an IL-2-specific primer (GTGTTGTAAGCAGGAGGTACATAGTTA) followed by 30 cycles of a first PCR amplification (5′: CATGCAGCTCGCATCCTGTGT; 3′: GTGTTGTAAGCAGGAGGTACATAGTTA). One microliter of a 50-μl reaction was used for a seminested second amplification of 26 cycles (5′: GAGCAGGATGGAGA ATTACAGG; 3′: GTGTTGTAAGCAGGAGGTACATAGTTA). The amplicons differ by a Fnu 4HI-sensitive sequence that allows the distinction of maternal C57BL/6 from paternal M. spretus DNA. The PCR reaction was analyzed on a 2% agarose gel after digestion of the amplicons. The expected product from the paternal M. spretus allele is 358 base pairs (bp), whereas the larger fragment of the digested C57BL/6 maternal allele is 229 bp (the smaller fragment of 129 bp is not shown in Fig. 4A). The single-cell RT-PCR used would be sufficiently sensitive to detect biallelic trantscription if it were present because IL-2-specific transcripts can still be amplified from 1:4 dilution of single-cell lysates. Moreover, mixing RNA at diverse ratios followed by RT-PCR allowed for the concurrent detection of both transcripts over a broad range of different concentrations (26).
  • 42
    • 0001470477 scopus 로고
    • J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
    • (1960) J. Biophys. Biochem. Cytol. , vol.7 , pp. 455
    • Taylor, J.H.1
  • 43
    • 0027205671 scopus 로고
    • J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
    • (1993) Nature , vol.364 , pp. 459
    • Kitsberg, D.1
  • 44
    • 0028260642 scopus 로고
    • J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
    • (1994) Nature Genet. , vol.6 , pp. 41
    • Knoll, J.H.1    Cheng, S.D.2    Lalande, M.3
  • 45
    • 0023867576 scopus 로고
    • 2 (pH 7.0) for 10 min at room temperature. The probes used, c-mpl and IL-2, were labeled by random priming with biotinylated 14-deoxycytidine triphosphate (Gibco-BRL). Cytogenetic preparations were denatured, immediately dehydrated, and then air-dried before overnight hybridization with denatured probes. The slides were then rinsed, and the signal was detected and amplified by incubation with FITC-conjugated avidin and biotinylated goat antibody to avidin (2 μg/ml each; Vector Laboratories). Samples were stained with propidium iodine for 5 min at 0.1 μg/ml in PBS and mounted. Samples were visualized at 100× magnification on a Zeiss microscope (Axiophot) equipped with epifluorescence optics for 4′,6′-diamidino-2-phenylindole and fluorescein. Images taken were intensified with the Nu200 charge-coupled device Camera System (Photometrics) and then processed with IPLabSpectrum (Signal Analytics) software.
    • (1988) Cell , vol.52 , pp. 51
    • Lawrence, J.B.1    Villanave, C.A.2    Singer, R.A.3
  • 49
    • 0025325169 scopus 로고
    • D. G. Schatz, M. A. Oettinger, M. S. Schlissel, Annu. Rev. Immunol. 10, 359 (1992); M. M. Davis, Cell 59, 475 (1990).
    • (1990) Cell , vol.59 , pp. 475
    • Davis, M.M.1
  • 50
    • 0024745372 scopus 로고
    • L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
    • (1989) Genomics , vol.5 , pp. 651
    • Fiorentine, L.1    Austen, D.2    Pravtcheva, D.3    Ruddle, F.H.4    Brownell, E.5
  • 51
    • 0025604758 scopus 로고
    • L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
    • (1990) Cytogenet. Cell Genet. , vol.54 , pp. 164
    • Webb, G.C.1    Campbell, H.D.2    Lee, J.S.3    Young, I.G.4
  • 52
    • 0024745372 scopus 로고
    • L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
    • (1994) Mouse Genome , vol.92 , pp. 108
    • Beechey, C.V.1    Cattanach, B.M.2
  • 54
    • 0021768586 scopus 로고
    • N. J. Holbrook et al., Proc. Natl. Acad. Sci. U.S.A. 81, 1634 (1984); A. Fuse et al., Nucleic Acids Res. 12, 9323 (1984).
    • (1984) Nucleic Acids Res. , vol.12 , pp. 9323
    • Fuse, A.1
  • 56
    • 0027922467 scopus 로고
    • N. Cerf-Bensussan, A. Quaroni, J. T. Kurnick, A. K. Bhan, J. Immunol. 132, 2244 (1984); P. Mombaerts et al., Cell 75, 275 (1993); S. A. Bogen, I. Fogelman, A. K. Abbas, J. Immunol. 150, 4197 (1993).
    • (1993) Cell , vol.75 , pp. 275
    • Mombaerts, P.1
  • 57
    • 0027153198 scopus 로고
    • N. Cerf-Bensussan, A. Quaroni, J. T. Kurnick, A. K. Bhan, J. Immunol. 132, 2244 (1984); P. Mombaerts et al., Cell 75, 275 (1993); S. A. Bogen, I. Fogelman, A. K. Abbas, J. Immunol. 150, 4197 (1993).
    • (1993) J. Immunol. , vol.150 , pp. 4197
    • Bogen, S.A.1    Fogelman, I.2    Abbas, A.K.3
  • 60
    • 7144255195 scopus 로고    scopus 로고
    • G. A. Holländer et al., data not shown
    • G. A. Holländer et al., data not shown.
  • 61
    • 7144251538 scopus 로고    scopus 로고
    • note
    • We thank I. Horak for the IL-2 knockout mice and the genomic IL-2 clone; R. Skoda for the c-mpl clone; A. Surani for the (C57BL6/6 × M. spretus) mice; P. Yacono and E. Ten Boekel for excellent technical assistance; and G. Balciunaite, J. Bluestone, W. Gehring, J. Seidman, C. Steinberg, and R. Zeller for helpful discussions. Supported by a grant from the Swiss National Science Foundation (31-43′600.95 to G.A.H.) and grants from the NIH (PO1 CA39542-09 and R01 Al17258-18 to S.J.B, RO1 DK47677 to A.K.B., P30 DK43351 to A.K.B and C.T., and HL32854 and HL15157 to D.E.G.).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.