-
1
-
-
0023907493
-
-
K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
-
(1988)
Science
, vol.240
, pp. 1169
-
-
Smith, K.A.1
-
2
-
-
0022557578
-
-
K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
-
(1986)
Immunol. Rev.
, vol.92
, pp. 121
-
-
Taniguchi, T.1
-
3
-
-
0024516721
-
-
K. A. Smith, Science 240, 1169 (1988); T. Taniguchi et al., Immunol. Rev. 92, 121 (1986); M. A. Tigges, L. S. Casey, M. E. Koshland, Science 243, 781 (1989).
-
(1989)
Science
, vol.243
, pp. 781
-
-
Tigges, M.A.1
Casey, L.S.2
Koshland, M.E.3
-
4
-
-
0026710448
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1992)
Clin. Exp. Immunol.
, vol.89
, pp. 204
-
-
Rump, J.A.1
-
5
-
-
0026478572
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1992)
J. Pediatr.
, vol.121
, pp. 873
-
-
Sorensen, R.U.1
Boehm, K.D.2
Kaplan, D.3
Berger, M.4
-
6
-
-
0026710448
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1989)
Proc. Natl. Acad. Sci. U.S.A.
, vol.86
, pp. 5069
-
-
Pawha, R.1
-
7
-
-
0024565744
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1989)
N. Engl. J. Med.
, vol.320
, pp. 696
-
-
Chatila, T.1
-
8
-
-
0025297840
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1990)
N. Engl. J. Med.
, vol.322
, pp. 1718
-
-
Weinberg, K.1
Parkman, R.2
-
9
-
-
0025289836
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1990)
J. Exp. Med.
, vol.171
, pp. 1697
-
-
Di-Santo, J.P.1
Keever, C.A.2
Small, T.N.3
Nichols, G.L.4
O'Reilly, R.J.5
-
10
-
-
0020063538
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1982)
J. Immunol.
, vol.128
, pp. 679
-
-
Lopez-Botet, M.1
Fontan, G.2
Garcia Rodriquez, M.C.3
De Landazuri, M.O.4
-
11
-
-
0020693418
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1983)
Clin. Exp. Immunol.
, vol.51
, pp. 338
-
-
Paganelli, R.1
Aiuti, F.2
Beverly, P.C.L.3
Levinsky, R.J.4
-
12
-
-
0023488504
-
-
J. A. Rump et al., Clin. Exp. Immunol. 89, 204 (1992); R. U. Sorensen, K. D. Boehm, D. Kaplan, M. Berger, J. Pediatr. 121, 873 (1992); R. Pawha et al., Proc. Natl. Acad. Sci. U.S.A. 86, 5069 (1989); T. Chatila et al., N. Engl. J. Med. 320, 696 (1989); K. Weinberg and R. Parkman, ibid. 322, 1718 (1990); J. P. Di-Santo, C. A. Keever, T. N. Small, G. L. Nichols, R. J. O'Reilly, J. Exp. Med. 171, 1697 (1990); M. Lopez-Botet, G. Fontan, M. C. Garcia Rodriquez, M. O. de Landazuri, J. Immunol. 128, 679 (1982); R. Paganelli, F. Aiuti, P. C. L. Beverly, R. J. Levinsky, Clin. Exp. Immunol. 51, 338 (1983); T. Ohno et al., Clin. Immunol. Immunopathol. 45, 471 (1987).
-
(1987)
Clin. Immunol. Immunopathol.
, vol.45
, pp. 471
-
-
Ohno, T.1
-
13
-
-
0027369395
-
-
B. Sadlack, H. Merz, H. Schorle, A. Schimpl, I. Horak, Cell 75, 253 (1993).
-
(1993)
Cell
, vol.75
, pp. 253
-
-
Sadlack, B.1
Merz, H.2
Schorle, H.3
Schimpl, A.4
Horak, I.5
-
14
-
-
0025855211
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1991)
J. Exp. Med.
, vol.173
, pp. 1323
-
-
Andreu-Sanchez, J.L.1
-
15
-
-
0026474396
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1992)
Eur. J. Immunol.
, vol.22
, pp. 2867
-
-
Gutierrez-Ramos, J.C.1
Moreno De Alboran, I.2
Martinez-A., C.3
-
16
-
-
0026871005
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1992)
Semin. Immunol.
, vol.4
, pp. 167
-
-
Kroemer, G.1
Martinez-A., C.2
-
17
-
-
0023914792
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1988)
Immunology
, vol.64
, pp. 413
-
-
Essery, G.1
Feldmann, M.2
Lamb, J.R.3
-
18
-
-
0025791940
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1991)
J. Immunol.
, vol.147
, pp. 3261
-
-
Desilva, D.R.1
Urdahl, K.B.2
Jenkins, M.K.3
-
19
-
-
0000778129
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1985)
Proc. Natl. Acad. Sci. U.S.A.
, vol.82
, pp. 536
-
-
Malkowsky, M.1
-
20
-
-
0023181427
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1987)
Transplantation
, vol.43
, pp. 523
-
-
Niederkorn, N.Y.1
-
21
-
-
0028215558
-
-
J. L. Andreu-Sanchez et al., J. Exp. Med. 173, 1323 (1991); J. C. Gutierrez-Ramos, I. Moreno de Alboran, C. Martinez-A., Eur. J. Immunol. 22, 2867 (1992); G. Kroemer and C. Martinez-A., Semin. Immunol. 4, 167 (1992); G. Essery, M. Feldmann, J. R. Lamb, Immunology 64, 413 (1988); D. R. Desilva, K. B. Urdahl, M. K. Jenkins, J. Immunol. 147, 3261 (1991); M. Malkowsky et al., Proc. Natl. Acad. Sci. U.S.A. 82, 536 (1985); N. Y. Niederkorn, Transplantation 43, 523 (1987); M. Sykes, M. W. Harty, G. L. Szot, D. A. Pearson, Blood 83, 2560 (1994).
-
(1994)
Blood
, vol.83
, pp. 2560
-
-
Sykes, M.1
Harty, M.W.2
Szot, G.L.3
Pearson, D.A.4
-
22
-
-
0028181498
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
(1994)
Immunol. Today
, vol.15
, pp. 225
-
-
Rudd, C.A.1
-
23
-
-
0028181498
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
Immunol. Today
, pp. 321
-
-
June, C.H.1
Bluestone, J.A.2
Nadler, L.M.3
Thompson, C.B.4
-
24
-
-
0028278268
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
(1994)
Curr. Opin. Immunol.
, vol.6
, pp. 385
-
-
Collins, T.A.1
Kassner, P.D.2
Bierer, B.E.3
Burakoff, S.J.4
-
25
-
-
0027403299
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
(1993)
Annu. Rev. Immunol.
, vol.11
, pp. 191
-
-
Linsley, P.S.1
Ledbetter, J.A.2
-
26
-
-
0028288927
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
(1994)
Annu. Rev. Immunol.
, vol.12
, pp. 555
-
-
Chan, A.C.1
Desai, D.M.2
Weiss, A.3
-
27
-
-
0028501442
-
-
C. A. Rudd et al., Immunol. Today 15, 225 (1994); C. H. June, J. A. Bluestone, L. M. Nadler, C. B. Thompson, ibid., p. 321; T. A. Collins, P. D. Kassner, B. E. Bierer, S. J. Burakoff, Curr. Opin. Immunol. 6, 385 (1994); P. S. Linsley and J. A. Ledbetter, Annu. Rev. Immunol. 11, 191 (1993); A. C. Chan, D. M. Desai, A. Weiss, ibid. 12, 555 (1994); M. K. Jenkins, Immunity 1, 443 (1994).
-
(1994)
Immunity
, vol.1
, pp. 443
-
-
Jenkins, M.K.1
-
28
-
-
0025255387
-
-
K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
-
(1990)
Annu. Rev. Immunol.
, vol.8
, pp. 421
-
-
Ullman, K.1
Northrop, J.P.2
Verweij, C.L.3
Crabtree, J.R.4
-
29
-
-
0028300431
-
-
K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
-
(1994)
Immunol. Today
, vol.15
, pp. 274
-
-
Rao, A.1
-
30
-
-
0025351406
-
-
K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
-
(1990)
Immunol. Today
, vol.11
, pp. 211
-
-
June, C.H.1
Ledbetter, J.A.2
Linsley, P.S.3
Thompson, C.B.4
-
31
-
-
0028329603
-
-
K. Ullman, J. P. Northrop, C. L. Verweij, J. R. Crabtree, Annu. Rev. Immunol. 8, 421 (1990); A. Rao. Immunol. Today 15, 274 (1994); C. H. June, J. A. Ledbetter, P. S. Linsley, C. B. Thompson, ibid. 11, 211 (1990); P. A. Garrity, D. Chen, E. V. Rothenberg, B. J. Wold, Moll. Cell. Biol. 14, 2159 (1994).
-
(1994)
Moll. Cell. Biol.
, vol.14
, pp. 2159
-
-
Garrity, P.A.1
Chen, D.2
Rothenberg, E.V.3
Wold, B.J.4
-
32
-
-
7144262064
-
-
note
-
- thymocytes stained for IL-2 further emphasizes the lack of a developmental advantage for thymocytes that produce IL-2.
-
-
-
-
33
-
-
7144255873
-
-
note
-
+ T cells but treated identically as outlined above served as negative controls, whereas the simultaneous addition of IL-2 and CTLL-20 cells served as the positive control. This measurement of IL-2 corrsponds to a modified method of (25).
-
-
-
-
34
-
-
7144262760
-
-
G. A. Holländer, K. Mobisson, S. J. Burakoff, unpublished results
-
G. A. Holländer, K. Mobisson, S. J. Burakoff, unpublished results.
-
-
-
-
37
-
-
7144250217
-
-
note
-
Fixed and rehydrated cytocentrifuged smears were stained with biotinylated mAb to IL-2 (JES6-5H4) followed by avidin-coupled fluorescein isothiocyanate (FITC) (Becton Dickinson). Single cells were scanned by ACAS interactive laser cytometry, and ACAS software (Meridian Instruments) was used to analyze the fluorescence scans.
-
-
-
-
39
-
-
0029811865
-
-
F. Matesanz and A. Alcina, Eur. J. Immunol. 26, 1675 (1996); _ and A. Pellicer, Immunogenetics 38, 300 (1993).
-
(1993)
Immunogenetics
, vol.38
, pp. 300
-
-
Pellicer, A.1
-
40
-
-
7144254124
-
-
note
-
+ T cells were then sorted by flow cytometry as single cells into 10 μl of 2× reverse transcription (RT) buffer containing 0.05% NP-40 and immediately frozen on dry ice. RT was done on single-cell lysates or fractions thereof with an IL-2-specific primer (GTGTTGTAAGCAGGAGGTACATAGTTA) followed by 30 cycles of a first PCR amplification (5′: CATGCAGCTCGCATCCTGTGT; 3′: GTGTTGTAAGCAGGAGGTACATAGTTA). One microliter of a 50-μl reaction was used for a seminested second amplification of 26 cycles (5′: GAGCAGGATGGAGA ATTACAGG; 3′: GTGTTGTAAGCAGGAGGTACATAGTTA). The amplicons differ by a Fnu 4HI-sensitive sequence that allows the distinction of maternal C57BL/6 from paternal M. spretus DNA. The PCR reaction was analyzed on a 2% agarose gel after digestion of the amplicons. The expected product from the paternal M. spretus allele is 358 base pairs (bp), whereas the larger fragment of the digested C57BL/6 maternal allele is 229 bp (the smaller fragment of 129 bp is not shown in Fig. 4A). The single-cell RT-PCR used would be sufficiently sensitive to detect biallelic trantscription if it were present because IL-2-specific transcripts can still be amplified from 1:4 dilution of single-cell lysates. Moreover, mixing RNA at diverse ratios followed by RT-PCR allowed for the concurrent detection of both transcripts over a broad range of different concentrations (26).
-
-
-
-
42
-
-
0001470477
-
-
J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
-
(1960)
J. Biophys. Biochem. Cytol.
, vol.7
, pp. 455
-
-
Taylor, J.H.1
-
43
-
-
0027205671
-
-
J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
-
(1993)
Nature
, vol.364
, pp. 459
-
-
Kitsberg, D.1
-
44
-
-
0028260642
-
-
J. H. Taylor, J. Biophys. Biochem. Cytol. 7, 455 (1960); D. Kitsberg et al., Nature 364, 459 (1993); J. H. Knoll, S. D. Cheng, M. Lalande, Nature Genet. 6, 41 (1994).
-
(1994)
Nature Genet.
, vol.6
, pp. 41
-
-
Knoll, J.H.1
Cheng, S.D.2
Lalande, M.3
-
45
-
-
0023867576
-
-
2 (pH 7.0) for 10 min at room temperature. The probes used, c-mpl and IL-2, were labeled by random priming with biotinylated 14-deoxycytidine triphosphate (Gibco-BRL). Cytogenetic preparations were denatured, immediately dehydrated, and then air-dried before overnight hybridization with denatured probes. The slides were then rinsed, and the signal was detected and amplified by incubation with FITC-conjugated avidin and biotinylated goat antibody to avidin (2 μg/ml each; Vector Laboratories). Samples were stained with propidium iodine for 5 min at 0.1 μg/ml in PBS and mounted. Samples were visualized at 100× magnification on a Zeiss microscope (Axiophot) equipped with epifluorescence optics for 4′,6′-diamidino-2-phenylindole and fluorescein. Images taken were intensified with the Nu200 charge-coupled device Camera System (Photometrics) and then processed with IPLabSpectrum (Signal Analytics) software.
-
(1988)
Cell
, vol.52
, pp. 51
-
-
Lawrence, J.B.1
Villanave, C.A.2
Singer, R.A.3
-
47
-
-
0027981484
-
-
A. Chess, I. Simon, H. Cedar, R. Axel, Cell 78, 823 (1994).
-
(1994)
Cell
, vol.78
, pp. 823
-
-
Chess, A.1
Simon, I.2
Cedar, H.3
Axel, R.4
-
48
-
-
0026708716
-
-
D. G. Schatz, M. A. Oettinger, M. S. Schlissel, Annu. Rev. Immunol. 10, 359 (1992); M. M. Davis, Cell 59, 475 (1990).
-
(1992)
Annu. Rev. Immunol.
, vol.10
, pp. 359
-
-
Schatz, D.G.1
Oettinger, M.A.2
Schlissel, M.S.3
-
49
-
-
0025325169
-
-
D. G. Schatz, M. A. Oettinger, M. S. Schlissel, Annu. Rev. Immunol. 10, 359 (1992); M. M. Davis, Cell 59, 475 (1990).
-
(1990)
Cell
, vol.59
, pp. 475
-
-
Davis, M.M.1
-
50
-
-
0024745372
-
-
L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
-
(1989)
Genomics
, vol.5
, pp. 651
-
-
Fiorentine, L.1
Austen, D.2
Pravtcheva, D.3
Ruddle, F.H.4
Brownell, E.5
-
51
-
-
0025604758
-
-
L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
-
(1990)
Cytogenet. Cell Genet.
, vol.54
, pp. 164
-
-
Webb, G.C.1
Campbell, H.D.2
Lee, J.S.3
Young, I.G.4
-
52
-
-
0024745372
-
-
L. Fiorentine, D. Austen, D. Pravtcheva, F. H. Ruddle, E. Brownell, Genomics 5, 651 (1989); G. C. Webb, H. D. Campbell, J. S. Lee, I. G. Young, Cytogenet. Cell Genet. 54, 164 (1990); C. V. Beechey and B. M. Cattanach, Mouse Genome 92, 108 (1994).
-
(1994)
Mouse Genome
, vol.92
, pp. 108
-
-
Beechey, C.V.1
Cattanach, B.M.2
-
54
-
-
0021768586
-
-
N. J. Holbrook et al., Proc. Natl. Acad. Sci. U.S.A. 81, 1634 (1984); A. Fuse et al., Nucleic Acids Res. 12, 9323 (1984).
-
(1984)
Nucleic Acids Res.
, vol.12
, pp. 9323
-
-
Fuse, A.1
-
55
-
-
0021339511
-
-
N. Cerf-Bensussan, A. Quaroni, J. T. Kurnick, A. K. Bhan, J. Immunol. 132, 2244 (1984); P. Mombaerts et al., Cell 75, 275 (1993); S. A. Bogen, I. Fogelman, A. K. Abbas, J. Immunol. 150, 4197 (1993).
-
(1984)
J. Immunol.
, vol.132
, pp. 2244
-
-
Cerf-Bensussan, N.1
Quaroni, A.2
Kurnick, J.T.3
Bhan, A.K.4
-
56
-
-
0027922467
-
-
N. Cerf-Bensussan, A. Quaroni, J. T. Kurnick, A. K. Bhan, J. Immunol. 132, 2244 (1984); P. Mombaerts et al., Cell 75, 275 (1993); S. A. Bogen, I. Fogelman, A. K. Abbas, J. Immunol. 150, 4197 (1993).
-
(1993)
Cell
, vol.75
, pp. 275
-
-
Mombaerts, P.1
-
57
-
-
0027153198
-
-
N. Cerf-Bensussan, A. Quaroni, J. T. Kurnick, A. K. Bhan, J. Immunol. 132, 2244 (1984); P. Mombaerts et al., Cell 75, 275 (1993); S. A. Bogen, I. Fogelman, A. K. Abbas, J. Immunol. 150, 4197 (1993).
-
(1993)
J. Immunol.
, vol.150
, pp. 4197
-
-
Bogen, S.A.1
Fogelman, I.2
Abbas, A.K.3
-
58
-
-
0025899598
-
-
H. Schorle, T. Holtschke, T. Hunig, A. Schimpl, I. Horak, Nature 352, 621 (1991).
-
(1991)
Nature
, vol.352
, pp. 621
-
-
Schorle, H.1
Holtschke, T.2
Hunig, T.3
Schimpl, A.4
Horak, I.5
-
60
-
-
7144255195
-
-
G. A. Holländer et al., data not shown
-
G. A. Holländer et al., data not shown.
-
-
-
-
61
-
-
7144251538
-
-
note
-
We thank I. Horak for the IL-2 knockout mice and the genomic IL-2 clone; R. Skoda for the c-mpl clone; A. Surani for the (C57BL6/6 × M. spretus) mice; P. Yacono and E. Ten Boekel for excellent technical assistance; and G. Balciunaite, J. Bluestone, W. Gehring, J. Seidman, C. Steinberg, and R. Zeller for helpful discussions. Supported by a grant from the Swiss National Science Foundation (31-43′600.95 to G.A.H.) and grants from the NIH (PO1 CA39542-09 and R01 Al17258-18 to S.J.B, RO1 DK47677 to A.K.B., P30 DK43351 to A.K.B and C.T., and HL32854 and HL15157 to D.E.G.).
-
-
-
|