메뉴 건너뛰기




Volumn 277, Issue 5328, 1997, Pages 955-959

Telomerase catalytic subunit homologs from fission yeast and human

Author keywords

[No Author keywords available]

Indexed keywords

MESSENGER RNA; RNA DIRECTED DNA POLYMERASE; TELOMERASE;

EID: 0030819894     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.277.5328.955     Document Type: Article
Times cited : (2121)

References (47)
  • 2
    • 0003509384 scopus 로고    scopus 로고
    • M. L. DePamphilis, Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
    • C. W. Greider, K. Collins, C. Autexier, in DNA Replication in Eukaryotic Cells, M. L. DePamphilis, Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1996) pp. 619-638.
    • (1996) DNA Replication in Eukaryotic Cells , pp. 619-638
    • Greider, C.W.1    Collins, K.2    Autexier, C.3
  • 3
    • 0019568388 scopus 로고
    • L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
    • (1981) Proc. Natl. Acad. Sci. U.S.A. , vol.78 , pp. 3015
    • Klobutcher, L.A.1    Swanton, M.T.2    Donini, P.3    Prescott, D.M.4
  • 4
    • 0029102354 scopus 로고
    • L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
    • (1995) Nature , vol.376 , pp. 403
    • McEachern, M.J.1    Blackburn, E.H.2
  • 5
    • 0031038170 scopus 로고    scopus 로고
    • L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
    • (1997) Nature , vol.385 , pp. 744
    • Cooper, J.P.1    Nimmo, E.R.2    Allshire, R.C.3    Cech, T.R.4
  • 6
    • 0031036351 scopus 로고    scopus 로고
    • L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
    • (1997) Science , vol.275 , pp. 986
    • Marcand, S.1    Gilson, E.2    Shore, D.3
  • 7
    • 0029563009 scopus 로고
    • L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
    • (1995) Science , vol.270 , pp. 1601
    • Zakian, V.A.1
  • 8
    • 0025279931 scopus 로고
    • C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
    • (1990) Nature , vol.345 , pp. 458
    • Harley, C.B.1    Futcher, A.B.2    Greider, C.W.3
  • 9
    • 0025143252 scopus 로고
    • C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
    • (1990) Nature , vol.346 , pp. 866
    • Hastie, N.D.1
  • 10
    • 0028673260 scopus 로고
    • C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
    • (1994) Cold Spring Harbor Symp. Quant. Biol. , vol.59 , pp. 307
    • Harley, C.B.1
  • 11
    • 0026523228 scopus 로고
    • C. M. Counter et al., EMBO J. 11, 1921 (1992); J. W. Shay and S. Bacchetti, Eur. J. Cancer 33, 787 (1997).
    • (1992) EMBO J. , vol.11 , pp. 1921
    • Counter, C.M.1
  • 13
    • 0028564951 scopus 로고
    • N. W. Kim et al., Science 266, 2011 (1994).
    • (1994) Science , vol.266 , pp. 2011
    • Kim, N.W.1
  • 14
    • 0029096515 scopus 로고
    • J. Feng et al., ibid. 269, 1236 (1995).
    • (1995) Science , vol.269 , pp. 1236
    • Feng, J.1
  • 16
    • 0031036350 scopus 로고    scopus 로고
    • L. Harrington et al., Science 275, 973 (1997); J. Nakayama, M. Saito, H. Nakamura, A. Matsuura, F. Ishikawa, Cell 88, 875 (1997).
    • (1997) Science , vol.275 , pp. 973
    • Harrington, L.1
  • 19
    • 0030938901 scopus 로고    scopus 로고
    • J. Lingner et al., Science 276, 561 (1997).
    • (1997) Science , vol.276 , pp. 561
    • Lingner, J.1
  • 24
    • 1842409139 scopus 로고    scopus 로고
    • note
    • + RNA from S. pombe was reverse transcribed using primer M2-B14 (CCTTG-GAAAAATCCATTGAAGCCACATGTG). The resulting cDNA was ligated to oligonucleotide pGGGCCGT-GTTGGCCTAGTTCTCTGCTCddA using T4 RNA ligase and amplified by two rounds of PCR: in the first round, we used primers M2-814 and Adapt-Sfi (GAGGAGGAGAAGAGCAGAGAACTAGGCCAACA-CGGCCC), and in the second, we used primers M2-B15 (AAAGTGGTATGCCAGAAATCTGAAGG-TAAT) and Adapt-Sfi.
  • 25
    • 0028233256 scopus 로고
    • M. Q. Zhang and T. G. Marr, Nucleic Acids Res. 22, 1750 (1994). Sequencing of the three original cDNA clones and nine cloned RT-PCR products revealed that two 3′ splice sites were used at similar frequency for splicing of intron 8. These sites were separated by 3 nts, giving rise to predicted proteins of 988 and 989 amino acids.
    • (1994) Nucleic Acids Res. , vol.22 , pp. 1750
    • Zhang, M.Q.1    Marr, T.G.2
  • 26
    • 0027266758 scopus 로고
    • V. Lundblad and E. H. Blackburn, Cell 73, 347 (1993); M. J. McEachern and E. H. Blackburn, Genes Dev. 10, 1822 (1996).
    • (1993) Cell , vol.73 , pp. 347
    • Lundblad, V.1    Blackburn, E.H.2
  • 29
    • 1842293514 scopus 로고    scopus 로고
    • note
    • A lambda cDNA library from the human 293 cell line, which has high levels of telomerase activity, was partitioned into 25 pools containing ∼200,000 plaques each. These were screened by PCR with primers LT5 (CGGAAGAGTGTCTGGAGCAA) and LT6 (GGATGAAGCGGAGTCTGGA) to the 5′ region of the #712562 clone insert. Six subpools of one positive primary pool were further screened by PCR. One positive subpool was then screened by plaque hybridization with a probe from the 5′ region of clone #712562. One phage was positively identified and the ∼4 kbp insert from this clone was excised and subcloned into the pBluescript II SK+ vector (Stratagene) as an Eco RI fragment.
  • 30
    • 1842413223 scopus 로고    scopus 로고
    • note
    • Polyadenylated RNAs from human testis and from the 293 cell line were amplified using a nested PCR strategy. The first primer set was TCP1.1 (GTGAAG-GCACTGTTCAGCG) and TCP1.15 (CGCGTGGGT-GAGGTGAGGTG); the second primer set was TCP1.14 (CTGTGCTGGGCCTGGACGATA) and DTCP6 (AGCTTGTTCTCCATGTCGCCGTAG).
  • 31
    • 1842331044 scopus 로고    scopus 로고
    • note
    • hTRT mRNA was amplified using oligonucleotide primers LT5 and LT6 (79) for 31 cycles (94°C for 45 s, 60°C for 45 s, 72°C for 90 s). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was amplified using primers K136 (CTCAGACACCAT-GGGGAAGGTGA) and K137 (ATGATCTTGAG-GCTGTTGTCATA) for 16 cycles (94°C for 45 S, 55°C for 45 s, 72°C for 90 s). hTR was amplified using primers F3b (TCTAACCCTAACTGAGAAGGGCG-TAG) and R3c (GTTTGCTCTAGAATGAACGGTG-GAAG) for 22 cycles (94°C for 45 S, 55°C for 45 S, 72°C for 90 s). TP1 mRNA was amplified using primers TP1.1 (TCAAGCCAAACCTGAATCTGAG) and TP1.2 (CCCGAGTGAATCTTTCTACGQ for 28 cycles (cycles same as for hTRT). Reaction products were resolved on an 8% polyacrylamide gel, stained with SYBR Green I (Molecular Probes, Eugene, OR).
  • 34
    • 0029052967 scopus 로고
    • A. Jacobo-Molina et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6320 (1993); P. H. Patel et al., Biochemistry 34, 5351 (1995).
    • (1995) Biochemistry , vol.34 , pp. 5351
    • Patel, P.H.1
  • 35
    • 0025006614 scopus 로고
    • Y. Xiong and T. H. Eickbush, EMBO J. 9, 3353 (1990); T. H. Bckbush, in The Evolutionary Biology of Viruses, S. S. Morse, Ed. (Raven, New York, 1994), pp. 121-157.
    • (1990) EMBO J. , vol.9 , pp. 3353
    • Xiong, Y.1    Eickbush, T.H.2
  • 36
    • 0002687402 scopus 로고
    • S. S. Morse, Ed. Raven, New York
    • Y. Xiong and T. H. Eickbush, EMBO J. 9, 3353 (1990); T. H. Bckbush, in The Evolutionary Biology of Viruses, S. S. Morse, Ed. (Raven, New York, 1994), pp. 121-157.
    • (1994) The Evolutionary Biology of Viruses , pp. 121-157
    • Bckbush, T.H.1
  • 39
    • 0025316079 scopus 로고
    • H. Biessmann et al., Cell 61, 663 (1990); R.W. Levis, R. Ganesan, K. Houtchens, L. A. Tolar, F. Sheen, ibid. 75, 1 (1993); M. L. Pardue, O. N. Danilevskaya, K. Lowenhaupt, F. Slot, K. L. Traverse, Trends Genet. 12, 48 (1996).
    • (1990) Cell , vol.61 , pp. 663
    • Biessmann, H.1
  • 40
    • 0025316079 scopus 로고
    • H. Biessmann et al., Cell 61, 663 (1990); R.W. Levis, R. Ganesan, K. Houtchens, L. A. Tolar, F. Sheen, ibid. 75, 1 (1993); M. L. Pardue, O. N. Danilevskaya, K. Lowenhaupt, F. Slot, K. L. Traverse, Trends Genet. 12, 48 (1996).
    • (1993) Cell , vol.75 , pp. 1
    • Levis, R.W.1    Ganesan, R.2    Houtchens, K.3    Tolar, L.A.4    Sheen, F.5
  • 42
    • 1842371613 scopus 로고    scopus 로고
    • note
    • +.
  • 44
    • 0023375195 scopus 로고
    • N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
    • (1987) Mol. Biol. Evol. , vol.4 , pp. 406
    • Saitou, N.1    Net, M.2
  • 45
    • 0027968068 scopus 로고
    • N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
    • (1994) Nucleic Acids Res. , vol.22 , pp. 4673
    • Thompson, J.D.1    Higgins, D.G.2    Gibson, T.J.3
  • 46
    • 0023375195 scopus 로고
    • N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
    • (1989) Cladistics , vol.5 , pp. 164
    • Felsenstein, J.1
  • 47
    • 1842414997 scopus 로고    scopus 로고
    • note
    • We thank R. Adams, B. Lastelic, L. Tonkin, and F. Wu for expert technical assistance; C. Chapon, J. P. Cooper, R. Gutell, E. Jabri, and J. Sperger for discussions; R. Allshire and J. A. Wise for plasmids and yeast strains; C. Mattison and the L. Pillus lab for help with microscopy; and A. Sirimarco for manuscript preparation. An S. pombe cDNA library was provided by C. J. Norbury and B. Edgar. Supported by NIH grant GM28039 (T.R.C).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.