Telomerase catalytic subunit homologs from fission yeast and human

Science

Volumn 277, Issue 5328, 1997, Pages 955-959

  Nakamura, Toru M ^a   Morin, Gregg B ^a   Chapman, Karen B ^a   Weinrich, Scott L ^a   Andrews, William H ^a   Lingner, Joachim ^a   Harley, Calvin B ^a   Cech, Thomas R ^a  

^a NONE

Author keywords

[No Author keywords available]

Indexed keywords

MESSENGER RNA; RNA DIRECTED DNA POLYMERASE; TELOMERASE;

ARTICLE; ENZYME ACTIVE SITE; ENZYME ACTIVITY; GENE DISRUPTION; HUMAN; NONHUMAN; PRIORITY JOURNAL; SCHIZOSACCHAROMYCES POMBE; SENESCENCE; TELOMERE;

AMINO ACID SEQUENCE; BINDING SITES; CATALYSIS; CELL LINE; DNA-BINDING PROTEINS; EVOLUTION, MOLECULAR; GENES, FUNGAL; HUMANS; INTRONS; MOLECULAR SEQUENCE DATA; PHYLOGENY; PROTEINS; RETROELEMENTS; RNA; RNA, MESSENGER; RNA-DIRECTED DNA POLYMERASE; SCHIZOSACCHAROMYCES; SCHIZOSACCHAROMYCES POMBE PROTEINS; SEQUENCE ALIGNMENT; TELOMERASE; TELOMERE;

CILIOPHORA; EUPLOTES AEDICULATUS; SACCHAROMYCES CEREVISIAE; SACCHAROMYCES POMBE; SCHIZOSACCHAROMYCES POMBE;

EID: 0030819894     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.277.5328.955     Document Type: Article

References (47)

1. C. W. Greider and E. H. Blackburn, Nature 337, 331 (1989).
2. C. W. Greider, K. Collins, C. Autexier, in DNA Replication in Eukaryotic Cells, M. L. DePamphilis, Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1996) pp. 619-638.
3. L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
4. L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
5. L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
6. L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
7. L. A. Klobutcher, M. T. Swanton, P. Donini, D. M. Prescott, Proc. Natl. Acad. Sci. U.S.A. 78, 3015 (1981); M. J. McEachern and E. H. Blackburn, Nature 376, 403 (1995); J. P. Cooper, E. R. Nimmo, R. C. Allshire, T. R. Cech, ibid. 385, 744 (1997); S. Marcand, E. Gilson, D. Shore, Science 275, 986 (1997); V. A. Zakian, ibid. 270, 1601 (1995).
8. C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
9. C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
10. C. B. Harley, A. B. Futcher, C. W. Greider, Nature 345, 458 (1990); N. D. Hastie et al., ibid. 346, 866 (1990); C. B. Harley et al., Cold Spring Harbor Symp. Quant. Biol. 59, 307 (1994).
11. C. M. Counter et al., EMBO J. 11, 1921 (1992); J. W. Shay and S. Bacchetti, Eur. J. Cancer 33, 787 (1997).
12. C. M. Counter et al., EMBO J. 11, 1921 (1992); J. W. Shay and S. Bacchetti, Eur. J. Cancer 33, 787 (1997).
13. N. W. Kim et al., Science 266, 2011 (1994).
14. J. Feng et al., ibid. 269, 1236 (1995).
15. K. Collins, R. Kobayashi, C. W. Greider, Cell 81, 677 (1995).
16. L. Harrington et al., Science 275, 973 (1997); J. Nakayama, M. Saito, H. Nakamura, A. Matsuura, F. Ishikawa, Cell 88, 875 (1997).
17. L. Harrington et al., Science 275, 973 (1997); J. Nakayama, M. Saito, H. Nakamura, A. Matsuura, F. Ishikawa, Cell 88, 875 (1997).
18. J. Lingner and T. R. Cech, Proc. Natl. Acad. Sci. U.S.A. 93, 10712 (1996).
19. J. Lingner et al., Science 276, 561 (1997).
20. T. S. Lendvay, D. K. Morris, J. Sah, B. Balasubramanian, V. Lundblad, Genetics 144, 1399 (1996).
21. C. M. Counter, M. Meyerson, E. N. Eaton, R. A. Weinberg, Proc. Natl. Acad. Sci. U.S.A., in press.
22. 5 colonies of an S. pombe cDNA library [J.-P. Javerzat, G. Cranston, R. C. Allshire, Nucleic Acids Res. 24, 4676 (1996)] were screened.
23. 5 colonies of an S. pombe cDNA library [J.-P. Javerzat, G. Cranston, R. C. Allshire, Nucleic Acids Res. 24, 4676 (1996)] were screened.
24. + RNA from S. pombe was reverse transcribed using primer M2-B14 (CCTTG-GAAAAATCCATTGAAGCCACATGTG). The resulting cDNA was ligated to oligonucleotide pGGGCCGT-GTTGGCCTAGTTCTCTGCTCddA using T4 RNA ligase and amplified by two rounds of PCR: in the first round, we used primers M2-814 and Adapt-Sfi (GAGGAGGAGAAGAGCAGAGAACTAGGCCAACA-CGGCCC), and in the second, we used primers M2-B15 (AAAGTGGTATGCCAGAAATCTGAAGG-TAAT) and Adapt-Sfi.
25. M. Q. Zhang and T. G. Marr, Nucleic Acids Res. 22, 1750 (1994). Sequencing of the three original cDNA clones and nine cloned RT-PCR products revealed that two 3′ splice sites were used at similar frequency for splicing of intron 8. These sites were separated by 3 nts, giving rise to predicted proteins of 988 and 989 amino acids.
26. V. Lundblad and E. H. Blackburn, Cell 73, 347 (1993); M. J. McEachern and E. H. Blackburn, Genes Dev. 10, 1822 (1996).
27. V. Lundblad and E. H. Blackburn, Cell 73, 347 (1993); M. J. McEachern and E. H. Blackburn, Genes Dev. 10, 1822 (1996).
28. 2-terminal motifs. In addition, the distance between motifs A and B′ was substantially shorter than that of the other three TRTs.
29. A lambda cDNA library from the human 293 cell line, which has high levels of telomerase activity, was partitioned into 25 pools containing ∼200,000 plaques each. These were screened by PCR with primers LT5 (CGGAAGAGTGTCTGGAGCAA) and LT6 (GGATGAAGCGGAGTCTGGA) to the 5′ region of the #712562 clone insert. Six subpools of one positive primary pool were further screened by PCR. One positive subpool was then screened by plaque hybridization with a probe from the 5′ region of clone #712562. One phage was positively identified and the ∼4 kbp insert from this clone was excised and subcloned into the pBluescript II SK+ vector (Stratagene) as an Eco RI fragment.
30. Polyadenylated RNAs from human testis and from the 293 cell line were amplified using a nested PCR strategy. The first primer set was TCP1.1 (GTGAAG-GCACTGTTCAGCG) and TCP1.15 (CGCGTGGGT-GAGGTGAGGTG); the second primer set was TCP1.14 (CTGTGCTGGGCCTGGACGATA) and DTCP6 (AGCTTGTTCTCCATGTCGCCGTAG).
31. hTRT mRNA was amplified using oligonucleotide primers LT5 and LT6 (79) for 31 cycles (94°C for 45 s, 60°C for 45 s, 72°C for 90 s). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was amplified using primers K136 (CTCAGACACCAT-GGGGAAGGTGA) and K137 (ATGATCTTGAG-GCTGTTGTCATA) for 16 cycles (94°C for 45 S, 55°C for 45 s, 72°C for 90 s). hTR was amplified using primers F3b (TCTAACCCTAACTGAGAAGGGCG-TAG) and R3c (GTTTGCTCTAGAATGAACGGTG-GAAG) for 22 cycles (94°C for 45 S, 55°C for 45 S, 72°C for 90 s). TP1 mRNA was amplified using primers TP1.1 (TCAAGCCAAACCTGAATCTGAG) and TP1.2 (CCCGAGTGAATCTTTCTACGQ for 28 cycles (cycles same as for hTRT). Reaction products were resolved on an 8% polyacrylamide gel, stained with SYBR Green I (Molecular Probes, Eugene, OR).
32. L A. Kohlstaedt, J. Wang, J. M. Friedman, P. A. Rice, T. A. Steitz, Science 256, 1783 (1992).
33. A. Jacobo-Molina et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6320 (1993); P. H. Patel et al., Biochemistry 34, 5351 (1995).
34. A. Jacobo-Molina et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6320 (1993); P. H. Patel et al., Biochemistry 34, 5351 (1995).
35. Y. Xiong and T. H. Eickbush, EMBO J. 9, 3353 (1990); T. H. Bckbush, in The Evolutionary Biology of Viruses, S. S. Morse, Ed. (Raven, New York, 1994), pp. 121-157.
36. Y. Xiong and T. H. Eickbush, EMBO J. 9, 3353 (1990); T. H. Bckbush, in The Evolutionary Biology of Viruses, S. S. Morse, Ed. (Raven, New York, 1994), pp. 121-157.
37. M. D. Powell et al., J. Biol. Chem. 272, 13262 (1997).
38. M. Ricchetti and H. Buc, Biochemistry 35, 14970 (1996).
39. H. Biessmann et al., Cell 61, 663 (1990); R.W. Levis, R. Ganesan, K. Houtchens, L. A. Tolar, F. Sheen, ibid. 75, 1 (1993); M. L. Pardue, O. N. Danilevskaya, K. Lowenhaupt, F. Slot, K. L. Traverse, Trends Genet. 12, 48 (1996).
40. H. Biessmann et al., Cell 61, 663 (1990); R.W. Levis, R. Ganesan, K. Houtchens, L. A. Tolar, F. Sheen, ibid. 75, 1 (1993); M. L. Pardue, O. N. Danilevskaya, K. Lowenhaupt, F. Slot, K. L. Traverse, Trends Genet. 12, 48 (1996).
41. H. Biessmann et al., Cell 61, 663 (1990); R.W. Levis, R. Ganesan, K. Houtchens, L. A. Tolar, F. Sheen, ibid. 75, 1 (1993); M. L. Pardue, O. N. Danilevskaya, K. Lowenhaupt, F. Slot, K. L. Traverse, Trends Genet. 12, 48 (1996).
42. +.
43. C. Alfa, P. Fantes, J. Hyams, M. McLoed, E. Warbrick, Experiments with Fission Yeast (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1993).
44. N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
45. N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
46. N. Saitou and M. Net, Mol. Biol. Evol. 4, 406 (1987). GenBank protein identification numbers of the sequences used in the phylogenetic analysis can be obtained from the authors. Alignment was analyzed using ClustalW 1.5 [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)) and PHYUP 3.5 [J. Felsenstein. Cladistics 5, 164 (1989)].
47. We thank R. Adams, B. Lastelic, L. Tonkin, and F. Wu for expert technical assistance; C. Chapon, J. P. Cooper, R. Gutell, E. Jabri, and J. Sperger for discussions; R. Allshire and J. A. Wise for plasmids and yeast strains; C. Mattison and the L. Pillus lab for help with microscopy; and A. Sirimarco for manuscript preparation. An S. pombe cDNA library was provided by C. J. Norbury and B. Edgar. Supported by NIH grant GM28039 (T.R.C).