메뉴 건너뛰기




Volumn 279, Issue 5353, 1998, Pages 1045-1047

Fission yeast Slp1: An effector of the Mad2-dependent spindle checkpoint

Author keywords

[No Author keywords available]

Indexed keywords

UBIQUITIN;

EID: 0000273639     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.279.5353.1045     Document Type: Article
Times cited : (327)

References (39)
  • 1
    • 0028962292 scopus 로고
    • A. W. Murray, Curr. Opin. Genet. Dev. 5, 5 (1995); W. A. E. Wells, Trends Cell Biol. 6, 228 (1996); R. B. Nicklas, Science 275, 632 (1997).
    • (1995) Curr. Opin. Genet. Dev. , vol.5 , pp. 5
    • Murray, A.W.1
  • 2
    • 0029949453 scopus 로고    scopus 로고
    • A. W. Murray, Curr. Opin. Genet. Dev. 5, 5 (1995); W. A. E. Wells, Trends Cell Biol. 6, 228 (1996); R. B. Nicklas, Science 275, 632 (1997).
    • (1996) Trends Cell Biol. , vol.6 , pp. 228
    • Wells, W.A.E.1
  • 3
    • 14444267778 scopus 로고    scopus 로고
    • A. W. Murray, Curr. Opin. Genet. Dev. 5, 5 (1995); W. A. E. Wells, Trends Cell Biol. 6, 228 (1996); R. B. Nicklas, Science 275, 632 (1997).
    • (1997) Science , vol.275 , pp. 632
    • Nicklas, R.B.1
  • 4
    • 0026009964 scopus 로고    scopus 로고
    • R. Li and A. W. Murray, Cell 66, 519 (1991); R.-H., Chen, J. C. Waters, E. D. Salmon, A. W. Murray, Science 274, 242 (1996); Y. Li and R. Benezra, ibid., p. 246.
    • (1991) Cell , vol.66 , pp. 519
    • Li, R.1    Murray, A.W.2
  • 6
    • 0026009964 scopus 로고    scopus 로고
    • R. Li and A. W. Murray, Cell 66, 519 (1991); R.-H., Chen, J. C. Waters, E. D. Salmon, A. W. Murray, Science 274, 242 (1996); Y. Li and R. Benezra, ibid., p. 246.
    • Science , pp. 246
    • Li, Y.1    Benezra, R.2
  • 9
    • 0025993769 scopus 로고
    • N. Sethi, M. C. Monteaguro, D. Koshland, E. Hogan, D. Burke, D. ibid. 11, 5592 (1991); I. A. Dawson, S. Roth, S. Artavanis-Tsakonas, J. Cell Biol. 129, 725 (1995); S. Sigrist, H. Jacobs, R. Stratmann, C. F. Lehner, EMBO J. 14, 4827 (1995); J. Weinstein, F. W. Jacobsen, J. Hsu-Chen, T. Wu, L. G. Baum, Mol. Cell. Biol. 14, 3350 (1994).
    • (1991) Mol. Cell. Biol. , vol.11 , pp. 5592
    • Sethi, N.1    Monteaguro, M.C.2    Koshland, D.3    Hogan, E.4    Burke, D.5
  • 10
    • 0028958186 scopus 로고
    • N. Sethi, M. C. Monteaguro, D. Koshland, E. Hogan, D. Burke, D. ibid. 11, 5592 (1991); I. A. Dawson, S. Roth, S. Artavanis-Tsakonas, J. Cell Biol. 129, 725 (1995); S. Sigrist, H. Jacobs, R. Stratmann, C. F. Lehner, EMBO J. 14, 4827 (1995); J. Weinstein, F. W. Jacobsen, J. Hsu-Chen, T. Wu, L. G. Baum, Mol. Cell. Biol. 14, 3350 (1994).
    • (1995) J. Cell Biol. , vol.129 , pp. 725
    • Dawson, I.A.1    Roth, S.2    Artavanis-Tsakonas, S.3
  • 11
    • 0029165112 scopus 로고
    • N. Sethi, M. C. Monteaguro, D. Koshland, E. Hogan, D. Burke, D. ibid. 11, 5592 (1991); I. A. Dawson, S. Roth, S. Artavanis-Tsakonas, J. Cell Biol. 129, 725 (1995); S. Sigrist, H. Jacobs, R. Stratmann, C. F. Lehner, EMBO J. 14, 4827 (1995); J. Weinstein, F. W. Jacobsen, J. Hsu-Chen, T. Wu, L. G. Baum, Mol. Cell. Biol. 14, 3350 (1994).
    • (1995) EMBO J. , vol.14 , pp. 4827
    • Sigrist, S.1    Jacobs, H.2    Stratmann, R.3    Lehner, C.F.4
  • 12
    • 0028256410 scopus 로고
    • N. Sethi, M. C. Monteaguro, D. Koshland, E. Hogan, D. Burke, D. ibid. 11, 5592 (1991); I. A. Dawson, S. Roth, S. Artavanis-Tsakonas, J. Cell Biol. 129, 725 (1995); S. Sigrist, H. Jacobs, R. Stratmann, C. F. Lehner, EMBO J. 14, 4827 (1995); J. Weinstein, F. W. Jacobsen, J. Hsu-Chen, T. Wu, L. G. Baum, Mol. Cell. Biol. 14, 3350 (1994).
    • (1994) Mol. Cell. Biol. , vol.14 , pp. 3350
    • Weinstein, J.1    Jacobsen, F.W.2    Hsu-Chen, J.3    Wu, T.4    Baum, L.G.5
  • 13
    • 0030835478 scopus 로고    scopus 로고
    • S. J. Sigrist and C. F. Lehner, Cell 90, 671 (1997); M. Schwab, A. S. Lutum, W. Seufert, ibid., p. 683; R. Visintin, S. Prinz, A. Amon, Science 278, 460 (1997).
    • (1997) Cell , vol.90 , pp. 671
    • Sigrist, S.J.1    Lehner, C.F.2
  • 14
    • 0030835478 scopus 로고    scopus 로고
    • S. J. Sigrist and C. F. Lehner, Cell 90, 671 (1997); M. Schwab, A. S. Lutum, W. Seufert, ibid., p. 683; R. Visintin, S. Prinz, A. Amon, Science 278, 460 (1997).
    • Cell , pp. 683
    • Schwab, M.1    Lutum, A.S.2    Seufert, W.3
  • 15
    • 0030693087 scopus 로고    scopus 로고
    • S. J. Sigrist and C. F. Lehner, Cell 90, 671 (1997); M. Schwab, A. S. Lutum, W. Seufert, ibid., p. 683; R. Visintin, S. Prinz, A. Amon, Science 278, 460 (1997).
    • (1997) Science , vol.278 , pp. 460
    • Visintin, R.1    Prinz, S.2    Amon, A.3
  • 18
    • 6844238927 scopus 로고    scopus 로고
    • note
    • + gene.
  • 19
    • 6844263133 scopus 로고    scopus 로고
    • note
    • GST-Slp1 and GST were purified with the glutathione-Sepharose 4B beads (GSH) as recommended by the manufacturer (Pharmacia). An in vitro-translated Mad2 protein was obtained with the use of reticulocyte lysate (Promega).
  • 20
    • 6844262735 scopus 로고    scopus 로고
    • note
    • + gene was inserted between two Sph I sites that were generated at ∼70 bp and 540 bp downstream of the putative translation initiation site of the gene.
  • 22
    • 6844231977 scopus 로고    scopus 로고
    • note
    • - leu1-32 ura4-d18) with ADH-M2. A detailed protocol will be available upon request.
  • 23
    • 6844225720 scopus 로고    scopus 로고
    • note
    • 2+.
  • 24
    • 6844237869 scopus 로고    scopus 로고
    • note
    • A pair of oligonucleotides, GGGCATATGTTTGTAAATTCTATCAGCAGTGACGTT and GGGCATATGAGTGTTAAAGCGTCGTTTAGCCGGTGT, were used for PCR.
  • 26
    • 6844232810 scopus 로고    scopus 로고
    • note
    • GST and GST-Mad2 were expressed and the binding assay was carried out as described (16).
  • 27
    • 0026089183 scopus 로고
    • M. Glotzer, A. W. Murray, M. W. Kirschner, Nature 349, 132 (1991); A. Hershko, D. Ganoth, J. Pehrson, R. E. Palazzo, L. H. Cohen, J. Biol. Chem. 266, 4940 (1991); O. Cohen-Fix, J. Peters, M. W. Kirschner, D. Koshland, Genes Dev. 10, 3081 (1996); H. Funabiki et al., Nature 381, 438 (1996); Y.-L. Juang et al., Science 275, 1311 (1997).
    • (1991) Nature , vol.349 , pp. 132
    • Glotzer, M.1    Murray, A.W.2    Kirschner, M.W.3
  • 28
    • 0026089183 scopus 로고
    • M. Glotzer, A. W. Murray, M. W. Kirschner, Nature 349, 132 (1991); A. Hershko, D. Ganoth, J. Pehrson, R. E. Palazzo, L. H. Cohen, J. Biol. Chem. 266, 4940 (1991); O. Cohen-Fix, J. Peters, M. W. Kirschner, D. Koshland, Genes Dev. 10, 3081 (1996); H. Funabiki et al., Nature 381, 438 (1996); Y.-L. Juang et al., Science 275, 1311 (1997).
    • (1991) J. Biol. Chem. , vol.266 , pp. 4940
    • Hershko, A.1    Ganoth, D.2    Pehrson, J.3    Palazzo, R.E.4    Cohen, L.H.5
  • 29
    • 0030448251 scopus 로고    scopus 로고
    • M. Glotzer, A. W. Murray, M. W. Kirschner, Nature 349, 132 (1991); A. Hershko, D. Ganoth, J. Pehrson, R. E. Palazzo, L. H. Cohen, J. Biol. Chem. 266, 4940 (1991); O. Cohen-Fix, J. Peters, M. W. Kirschner, D. Koshland, Genes Dev. 10, 3081 (1996); H. Funabiki et al., Nature 381, 438 (1996); Y.-L. Juang et al., Science 275, 1311 (1997).
    • (1996) Genes Dev. , vol.10 , pp. 3081
    • Cohen-Fix, O.1    Peters, J.2    Kirschner, M.W.3    Koshland, D.4
  • 30
    • 0030013594 scopus 로고    scopus 로고
    • M. Glotzer, A. W. Murray, M. W. Kirschner, Nature 349, 132 (1991); A. Hershko, D. Ganoth, J. Pehrson, R. E. Palazzo, L. H. Cohen, J. Biol. Chem. 266, 4940 (1991); O. Cohen-Fix, J. Peters, M. W. Kirschner, D. Koshland, Genes Dev. 10, 3081 (1996); H. Funabiki et al., Nature 381, 438 (1996); Y.-L. Juang et al., Science 275, 1311 (1997).
    • (1996) Nature , vol.381 , pp. 438
    • Funabiki, H.1
  • 31
    • 0031055137 scopus 로고    scopus 로고
    • M. Glotzer, A. W. Murray, M. W. Kirschner, Nature 349, 132 (1991); A. Hershko, D. Ganoth, J. Pehrson, R. E. Palazzo, L. H. Cohen, J. Biol. Chem. 266, 4940 (1991); O. Cohen-Fix, J. Peters, M. W. Kirschner, D. Koshland, Genes Dev. 10, 3081 (1996); H. Funabiki et al., Nature 381, 438 (1996); Y.-L. Juang et al., Science 275, 1311 (1997).
    • (1997) Science , vol.275 , pp. 1311
    • Juang, Y.-L.1
  • 32
    • 0029033504 scopus 로고    scopus 로고
    • S. Irniger, S. Piatti, C. Michaelis, K. Nasmyth, Cell 81, 269 (1995); R. W. King et al., ibid., p. 279; W. Zachariae, T. H. Shin, M. Galova, B. Obermaier, K. Nasmyth, Science 274, 1201 (1996); R. King, R. J. Deshaies, J. M. Peters, M. W. Kirschner, ibid., p. 1652.
    • (1995) Cell , vol.81 , pp. 269
    • Irniger, S.1    Piatti, S.2    Michaelis, C.3    Nasmyth, K.4
  • 33
    • 0029033504 scopus 로고    scopus 로고
    • S. Irniger, S. Piatti, C. Michaelis, K. Nasmyth, Cell 81, 269 (1995); R. W. King et al., ibid., p. 279; W. Zachariae, T. H. Shin, M. Galova, B. Obermaier, K. Nasmyth, Science 274, 1201 (1996); R. King, R. J. Deshaies, J. M. Peters, M. W. Kirschner, ibid., p. 1652.
    • Cell , pp. 279
    • King, R.W.1
  • 34
    • 0343829343 scopus 로고    scopus 로고
    • S. Irniger, S. Piatti, C. Michaelis, K. Nasmyth, Cell 81, 269 (1995); R. W. King et al., ibid., p. 279; W. Zachariae, T. H. Shin, M. Galova, B. Obermaier, K. Nasmyth, Science 274, 1201 (1996); R. King, R. J. Deshaies, J. M. Peters, M. W. Kirschner, ibid., p. 1652.
    • (1996) Science , vol.274 , pp. 1201
    • Zachariae, W.1    Shin, T.H.2    Galova, M.3    Obermaier, B.4    Nasmyth, K.5
  • 35
    • 0029807944 scopus 로고    scopus 로고
    • S. Irniger, S. Piatti, C. Michaelis, K. Nasmyth, Cell 81, 269 (1995); R. W. King et al., ibid., p. 279; W. Zachariae, T. H. Shin, M. Galova, B. Obermaier, K. Nasmyth, Science 274, 1201 (1996); R. King, R. J. Deshaies, J. M. Peters, M. W. Kirschner, ibid., p. 1652.
    • Science , pp. 1652
    • King, R.1    Deshaies, R.J.2    Peters, J.M.3    Kirschner, M.W.4
  • 37
  • 39
    • 6844222337 scopus 로고    scopus 로고
    • note
    • We thank G. Hannon and D. Beach for the cDNA library for the yeast two-hybrid system, P. Russell for pJL205, M. Yanagida for cut mutants and criticism of the manuscript, A. W. Murray for criticism of the manuscript and for sharing unpublished results, and G. Grills and D. Gebhard for technical assistance. D.P.L. was a Medical Student Research Fellow of the Howard Hughes Medical Institute and is supported by a training grant from the National Institutes of Health (5T32GM07491). A.K. was supported by the Human Frontier Science program. Supported by a grant from the National Institutes of Health (R01GM56305) to T.M.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.