메뉴 건너뛰기




Volumn 1, Issue 1, 2005, Pages 53-56

One-step, non-denaturing isolation of an RNA polymerase enzyme complex using an improved multi-use affinity probe resin

Author keywords

[No Author keywords available]

Indexed keywords

CYSTEINE; DITHIOL DERIVATIVE; DNA DIRECTED RNA POLYMERASE; DRUG DERIVATIVE; RESIN; TOLUENE;

EID: 33644811688     PISSN: 1742206X     EISSN: 17422051     Source Type: Journal    
DOI: 10.1039/b500950b     Document Type: Article
Times cited : (21)

References (22)
  • 11
    • 33644805493 scopus 로고    scopus 로고
    • The gene of RNA Polymerase A (rpoA) from S. oneidensis was amplified by PCR and cloned into the pBAD-DTOPO 202 vector (Invitrogen) according the manufacturer's protocol. To add the tetracysteine tag on the C-terminus of RpoA, the reverse primer (5′- CTTGCAACAACCAGGGCAACATGCAGCTAGGTCGTCTGCTAAACTAGCTG) contained the coding sequence for AACCPGCCK (marked in bold). The forward primer (5′- CACCCAGAGTACGGTTTACAGTTACGC) was used to amplify both coding and promoter region of rpoA. pBAD-DTOPO 202 also adds the 6His and V5 tags to the recombinant RpoA for purification and identification
    • The gene of RNA Polymerase A (rpoA) from S. oneidensis was amplified by PCR and cloned into the pBAD-DTOPO 202 vector (Invitrogen) according the manufacturer's protocol. To add the tetracysteine tag on the C-terminus of RpoA, the reverse primer (5′- CTTGCAACAACCAGGGCAACATGCAGCTAGGTCGTCTGCTAAACTAGCTG) contained the coding sequence for AACCPGCCK (marked in bold). The forward primer (5′- CACCCAGAGTACGGTTTACAGTTACGC) was used to amplify both coding and promoter region of rpoA. pBAD-DTOPO 202 also adds the 6His and V5 tags to the recombinant RpoA for purification and identification
  • 14
    • 33644796999 scopus 로고    scopus 로고
    • 50 mM HEPES, 140 mM sodium chloride, 5 mM 2-mercaptoethanol, pH 7.5 was the buffer used
    • 50 mM HEPES, 140 mM sodium chloride, 5 mM 2-mercaptoethanol, pH 7.5 was the buffer used


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.