-
4
-
-
0037050026
-
-
A. C. Gavin M. Bosche R. Krause P. Grandi M. Marzioch A. Bauer J. Schultz J. M. Rick A. M. Michon C. M. Cruciat M. Remor C. Hofert M. Schelder M. Brajenovic H. Ruffner A. Merino K. Klein M. Hudak D. Dickson T. Rudi V. Gnau A. Bauch S. Bastuck B. Huhse C. Leutwein M. A. Heurtier R. R. Copley A. Edelmann E. Querfurth V. Rybin G. Drewes M. Raida T. Bouwmeester P. Bork B. Seraphin B. Kuster G. Neubauer G. Superti-Furga Nature 2002 415 141 147
-
(2002)
Nature
, vol.415
, pp. 141-147
-
-
Gavin, A.C.1
Bosche, M.2
Krause, R.3
Grandi, P.4
Marzioch, M.5
Bauer, A.6
Schultz, J.7
Rick, J.M.8
Michon, A.M.9
Cruciat, C.M.10
Remor, M.11
Hofert, C.12
Schelder, M.13
Brajenovic, M.14
Ruffner, H.15
Merino, A.16
Klein, K.17
Hudak, M.18
Dickson, D.19
Rudi, T.20
Gnau, V.21
Bauch, A.22
Bastuck, S.23
Huhse, B.24
Leutwein, C.25
Heurtier, M.A.26
Copley, R.R.27
Edelmann, A.28
Querfurth, E.29
Rybin, V.30
Drewes, G.31
Raida, M.32
Bouwmeester, T.33
Bork, P.34
Seraphin, B.35
Kuster, B.36
Neubauer, G.37
Superti-Furga, G.38
more..
-
5
-
-
0037050004
-
-
Y. Ho A. Gruhler A. Heilbut G. D. Bader L. Moore S. L. Adams A. Millar P. Taylor K. Bennett K. Boutilier L. Y. Yang C. Wolting I. Donaldson S. Schandorff J. Shewnarane M. Vo J. Taggart M. Goudreault B. Muskat C. Alfarano D. Dewar Z. Lin K. Michalickova A. R. Willems H. Sassi P. A. Nielsen K. J. Rasmussen J. R. Andersen L. E. Johansen L. H. Hansen H. Jespersen A. Podtelejnikov E. Nielsen J. Crawford V. Poulsen B. D. Sorensen J. Matthiesen R. C. Hendrickson F. Gleeson T. Pawson M. F. Moran D. Durocher M. Mann C. W. V. Hogue D. Figeys M. Tyers Nature 2002 415 180 183
-
(2002)
Nature
, vol.415
, pp. 180-183
-
-
Ho, Y.1
Gruhler, A.2
Heilbut, A.3
Bader, G.D.4
Moore, L.5
Adams, S.L.6
Millar, A.7
Taylor, P.8
Bennett, K.9
Boutilier, K.10
Yang, L.Y.11
Wolting, C.12
Donaldson, I.13
Schandorff, S.14
Shewnarane, J.15
Vo, M.16
Taggart, J.17
Goudreault, M.18
Muskat, B.19
Alfarano, C.20
Dewar, D.21
Lin, Z.22
Michalickova, K.23
Willems, A.R.24
Sassi, H.25
Nielsen, P.A.26
Rasmussen, K.J.27
Andersen, J.R.28
Johansen, L.E.29
Hansen, L.H.30
Jespersen, H.31
Podtelejnikov, A.32
Nielsen, E.33
Crawford, J.34
Poulsen, V.35
Sorensen, B.D.36
Matthiesen, J.37
Hendrickson, R.C.38
Gleeson, F.39
Pawson, T.40
Moran, M.F.41
Durocher, D.42
Mann, M.43
Hogue, C.W.V.44
Figeys, D.45
Tyers, M.46
more..
-
9
-
-
0037140742
-
-
S. R. Adams R. E. Campbell L. A. Gross B. R. Martin G. K. Walkup Y. Yao J. Llopis R. Y. Tsien J. Am. Chem. Soc. 2002 124 6063 6076
-
(2002)
J. Am. Chem. Soc.
, vol.124
, pp. 6063-6076
-
-
Adams, S.R.1
Campbell, R.E.2
Gross, L.A.3
Martin, B.R.4
Walkup, G.K.5
Yao, Y.6
Llopis, J.7
Tsien, R.Y.8
-
11
-
-
33644805493
-
-
The gene of RNA Polymerase A (rpoA) from S. oneidensis was amplified by PCR and cloned into the pBAD-DTOPO 202 vector (Invitrogen) according the manufacturer's protocol. To add the tetracysteine tag on the C-terminus of RpoA, the reverse primer (5′- CTTGCAACAACCAGGGCAACATGCAGCTAGGTCGTCTGCTAAACTAGCTG) contained the coding sequence for AACCPGCCK (marked in bold). The forward primer (5′- CACCCAGAGTACGGTTTACAGTTACGC) was used to amplify both coding and promoter region of rpoA. pBAD-DTOPO 202 also adds the 6His and V5 tags to the recombinant RpoA for purification and identification
-
The gene of RNA Polymerase A (rpoA) from S. oneidensis was amplified by PCR and cloned into the pBAD-DTOPO 202 vector (Invitrogen) according the manufacturer's protocol. To add the tetracysteine tag on the C-terminus of RpoA, the reverse primer (5′- CTTGCAACAACCAGGGCAACATGCAGCTAGGTCGTCTGCTAAACTAGCTG) contained the coding sequence for AACCPGCCK (marked in bold). The forward primer (5′- CACCCAGAGTACGGTTTACAGTTACGC) was used to amplify both coding and promoter region of rpoA. pBAD-DTOPO 202 also adds the 6His and V5 tags to the recombinant RpoA for purification and identification
-
-
-
-
14
-
-
33644796999
-
-
50 mM HEPES, 140 mM sodium chloride, 5 mM 2-mercaptoethanol, pH 7.5 was the buffer used
-
50 mM HEPES, 140 mM sodium chloride, 5 mM 2-mercaptoethanol, pH 7.5 was the buffer used
-
-
-
-
15
-
-
0035387847
-
-
Y. Shen N. Tolic R. Zhao L. Pasa-Tolic L. Li S. J. Berger R. Harkewicz G. A. Anderson M. E. Belov R. D. Smith Anal. Chem. 2001 73 3011 3021
-
(2001)
Anal. Chem.
, vol.73
, pp. 3011-3021
-
-
Shen, Y.1
Tolic, N.2
Zhao, R.3
Pasa-Tolic, L.4
Li, L.5
Berger, S.J.6
Harkewicz, R.7
Anderson, G.A.8
Belov, M.E.9
Smith, R.D.10
-
16
-
-
4444350538
-
-
E. F. Strittmatter L. J. Kangas K. Petritis H. M. Mottaz G. A. Anderson Y. Shen J. M. Jacobs D. G. Camp R. D. Smith J. Proteome Res. 2004 3 760 769
-
(2004)
J. Proteome Res.
, vol.3
, pp. 760-769
-
-
Strittmatter, E.F.1
Kangas, L.J.2
Petritis, K.3
Mottaz, H.M.4
Anderson, G.A.5
Shen, Y.6
Jacobs, J.M.7
Camp, D.G.8
Smith, R.D.9
-
21
-
-
0037134035
-
-
G. Gaietta T. J. Deerinck S. R. Adams J. Bouwer O. Tour D. W. Laird G. E. Sosinsky R. Y. Tsien M. H. Ellisman Science 2002 296 503 507
-
(2002)
Science
, vol.296
, pp. 503-507
-
-
Gaietta, G.1
Deerinck, T.J.2
Adams, S.R.3
Bouwer, J.4
Tour, O.5
Laird, D.W.6
Sosinsky, G.E.7
Tsien, R.Y.8
Ellisman, M.H.9
|