메뉴 건너뛰기




Volumn 281, Issue 5374, 1998, Pages 269-272

Specific covalent labeling of recombinant protein molecules inside live cells

Author keywords

[No Author keywords available]

Indexed keywords

RECOMBINANT PROTEIN;

EID: 0032503999     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.281.5374.269     Document Type: Article
Times cited : (1331)

References (23)
  • 8
    • 2642628977 scopus 로고    scopus 로고
    • note
    • Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; E, Glu; R, Arg; W, Trp; and X, any amino acid.
  • 10
    • 2642624903 scopus 로고    scopus 로고
    • thesis, University of California, San Diego
    • B. A. Griffin, thesis, University of California, San Diego (1998).
    • (1998)
    • Griffin, B.A.1
  • 14
    • 0030610646 scopus 로고    scopus 로고
    • A. Miyawaki, et al., Nature 388, 882 (1997).
    • (1997) Nature , vol.388 , pp. 882
    • Miyawaki, A.1
  • 15
    • 0029847806 scopus 로고    scopus 로고
    • M. Ormö et al., Science 273, 1392 (1996).
    • (1996) Science , vol.273 , pp. 1392
    • Ormö, M.1
  • 17
  • 20
    • 2642658650 scopus 로고    scopus 로고
    • note
    • -1 at 507.5 nm at pH 7. The peptide Ac-Trp-Glu-Ala-Ala-Ala-Arg-Glu-Ala-Cys-Cys-Arg-Glu-Cys-Cys-Ala-Arg-Ala-amide was prepared by standard solid-phase methods and purified by n-butanol/water countercurrent chromatography.
  • 21
    • 2642636108 scopus 로고    scopus 로고
    • note
    • ECFP (14) is Aequorea victoria GFP with mammalian codons and the following additional mutations: K26R, F64L, S65T, Y66W, N146I, M153T, V163A, and N164H (8). A gene encoding a fusion of the peptide Ala-Glu-Ala-Ala-Ala-Arg-Glu-Ala-Cys-Cys-Arg-Glu-Cys-Cys-Ala-Arg-Ala to the COOH-terminus of ECFP was created with the following primer in a polymerase chain reaction (PCR): 5′- GCCGAATTCTTAGGCCCTGGCGCAGCACTCCCTGCAGCAGGCCTCCCTGGCGGCGGCCTCGGCCTTGTACAGCTCGTCCA TGCCG-3′. The resulting gene was inserted into the pcDNAB vector (Invitrogen) at Hind III and Eco RI restriction sites. After amplification in DH5 bacteria, it was transfected into HeLa cells with Lipofectin (Gibco-BRL). The gene for Xenopus calmodulin was mutated to encode cysteines at residues 6, 7, 10, and 11 by PCR with the following primer: 5′- CGCGGATCCGCCACCATGCATGACCAACTGACATGCTGCCAGATTTGCTGCTTCAAAGAAGCCTTCTCATTATTC- 3′ and inserted into pcDNA3 as described above.
  • 22
    • 2642663781 scopus 로고    scopus 로고
    • note
    • Images of cells at room temperature were acquired with a cooled charge-coupled device camera (Photometrics, Tucson, AZ) controlled by Metafluor software (Universal Imaging, West Chester, PA).
  • 23
    • 2642599268 scopus 로고    scopus 로고
    • note
    • Supported by NIH (grant NS27177 to R.Y.T. and a traineeship to B.A.G. from grant T32 CA09523) and the Howard Hughes Medical Institute. R.Y.T. is a consultant for Aurora Biosciences Corp. We thank L. A. Gross for mass spectra, A. Miyawaki for help with molecular biology, and T. Knapp for help with toxicity testing.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.