메뉴 건너뛰기




Volumn 280, Issue 5370, 1998, Pages 1750-1752

Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes

Author keywords

[No Author keywords available]

Indexed keywords

ALPHA FETOPROTEIN; CD19 ANTIGEN; DNA; IMMUNOGLOBULIN; IMMUNOGLOBULIN D; IMMUNOGLOBULIN HEAVY CHAIN; IMMUNOGLOBULIN M;

EID: 2642623612     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.280.5370.1750     Document Type: Article
Times cited : (471)

References (31)
  • 4
    • 0028270307 scopus 로고
    • A. Betz et al., Cell 77, 239 (1994).
    • (1994) Cell , vol.77 , pp. 239
    • Betz, A.1
  • 7
    • 2642608501 scopus 로고    scopus 로고
    • note
    • + B cells (Table 1) are unlikely to have undergone somatic mutation.
  • 8
    • 2642676706 scopus 로고    scopus 로고
    • B cells were pelleted and resuspended, and one volume of 2X DNA lysis buffer [proteinase K (1 mg/ml), 100 mM EDTA (pH 8.0), 2% SDS, and 100 mM tris (pH 8.0)] was added. The lysate was incubated at 37°C overnight. DNAs were extracted twice with phenol and then twice with phenol/chloroform/isoamyl alcohol (25:24:1). DNAs were precipitated with ethanol, pelleted, and dissolved in distilled water
    • B cells were pelleted and resuspended, and one volume of 2X DNA lysis buffer [proteinase K (1 mg/ml), 100 mM EDTA (pH 8.0), 2% SDS, and 100 mM tris (pH 8.0)] was added. The lysate was incubated at 37°C overnight. DNAs were extracted twice with phenol and then twice with phenol/chloroform/isoamyl alcohol (25:24:1). DNAs were precipitated with ethanol, pelleted, and dissolved in distilled water.
  • 9
    • 2642616034 scopus 로고    scopus 로고
    • note
    • We used the following primers: BCL-6 gene primers, 5′-GCTCTAGACCGCTGCTCATGATCATTAT-TT(sense), 5′-CGGGGTACCTAGACACGATACT-TCATCTCAT (antisense) or 5′-CCGCTGCTCAT-GATCATTATTT (sense), 5′-TAGACACGATACT-TCATCTCAT (antisense); c-MYC gene primers, 5′-CCGGTACCCTTGCCGCATCCACGAAACTTT (sense), 5′-GCTCTAGAGACCCAGGTTTTA (antisense); S14 gene primers, 5′-CGGGGTACCCGG-GACAGACGTGGGCTCCCG (sense), GCTCTAG-ATCTAAGGGAGAGAGAAACTGAC (antisense); AFP gene primers, 5′-GGATGAATGGTTTGTA-TGTTTC (sense), GGTTTGACTCATGAGATTTC (antisense). PCR conditions for BCL-6, c-MYC, and AFP were 94°C for 5 min, 57°C for 30 s, 75°C for 1 min, 1 cycle; 94°C for 30 s, 57°C for 30 s, 75°C for 1 min, 29 cycles; and 75°C for 6 min, 1 cycle. PCR conditions for S14 were 95°C for 5 min, 67°C for 30 s, 75°C for 1 min, 1 cycle; 95°C for 30 s, 67°C for 30 s, 75°C for 1 min, 29 cycles; and 75°C for 6 min, 1 cycle.
  • 10
    • 0021278366 scopus 로고
    • R. Taub et al., Cell 36, 339 (1984).
    • (1984) Cell , vol.36 , pp. 339
    • Taub, R.1
  • 12
    • 2642641936 scopus 로고    scopus 로고
    • BCL-6 DNA fragments from memory B cells were inserted into pBluescript KS at Kpn I and Xba I sites, and the other gene fragments and BCL-6 from naive B cells were inserted into the Srf I site in pBluescript SK according to manufacturer's instructions (Strategene). Plasmids with the inserts were transformed into Escherichia coli JH3
    • BCL-6 DNA fragments from memory B cells were inserted into pBluescript KS at Kpn I and Xba I sites, and the other gene fragments and BCL-6 from naive B cells were inserted into the Srf I site in pBluescript SK according to manufacturer's instructions (Strategene). Plasmids with the inserts were transformed into Escherichia coli JH3.
  • 13
    • 2642704855 scopus 로고    scopus 로고
    • Automated sequencing was done for all amplified gene fragments. Manual sequencing was performed to confirm some mutations. Sequences were aligned with the data from GenBank and (25) by MacVector4.14 to find mutations
    • Automated sequencing was done for all amplified gene fragments. Manual sequencing was performed to confirm some mutations. Sequences were aligned with the data from GenBank and (25) by MacVector4.14 to find mutations.
  • 14
    • 2642683032 scopus 로고    scopus 로고
    • 5 bp per cycle (26). Thus, for 30 cycles, roughly one mutation in 26,000 bp would be expected
    • 5 bp per cycle (26). Thus, for 30 cycles, roughly one mutation in 26,000 bp would be expected.
  • 15
    • 2642646899 scopus 로고    scopus 로고
    • Compared with the GenBank sequences, many changes were seen in BCL-6 in all four donors and in S14 donor A
    • Compared with the GenBank sequences, many changes were seen in BCL-6 in all four donors and in S14 donor A.
  • 17
    • 2642683031 scopus 로고    scopus 로고
    • H4 family genes were sequenced from positions 130 to 296 of V. Seven of the nine genes were mutated with 5 to 24 mutations per 167 nucleotides
    • H4 family genes were sequenced from positions 130 to 296 of V. Seven of the nine genes were mutated with 5 to 24 mutations per 167 nucleotides.
  • 18
    • 0001180652 scopus 로고    scopus 로고
    • A. Migliazza et al., Blood 90 (suppl. 1, pt. 1), 177a (1997).
    • (1997) Blood , vol.90 , Issue.SUPPL. 1 AND PART 1
    • Migliazza, A.1
  • 23
    • 2642650947 scopus 로고    scopus 로고
    • U. Storb et al., in preparation
    • U. Storb et al., in preparation.
  • 30
    • 0021378551 scopus 로고
    • C. Gazin et al., EMBO J. 3, 383 (1984).
    • (1984) EMBO J. , vol.3 , pp. 383
    • Gazin, C.1
  • 31
    • 2642713165 scopus 로고    scopus 로고
    • Supported by NIH grant GM38649 to U.S. A.P. was partly supported by NIH training grant GM07183. We thank T. McKeithan, T. E. Martin, N. Michael, and P. Engler for critical reading of the manuscript
    • Supported by NIH grant GM38649 to U.S. A.P. was partly supported by NIH training grant GM07183. We thank T. McKeithan, T. E. Martin, N. Michael, and P. Engler for critical reading of the manuscript.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.