메뉴 건너뛰기




Volumn 287, Issue 5457, 2000, Pages 1453-1460

An oral vaccine against NMDAR1 with efficacy in experimental stroke and epilepsy

Author keywords

[No Author keywords available]

Indexed keywords

4 AMINOBUTYRIC ACID; AUTOANTIBODY; GLUTAMATE DECARBOXYLASE; IMMUNOGLOBULIN G; N METHYL DEXTRO ASPARTIC ACID RECEPTOR; N METHYL DEXTRO ASPARTIC ACID RECEPTOR BLOCKING AGENT; VACCINE;

EID: 17944388584     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.287.5457.1453     Document Type: Article
Times cited : (204)

References (47)
  • 6
    • 0032575065 scopus 로고    scopus 로고
    • S. Das et al., Nature 393, 377 (1998).
    • (1998) Nature , vol.393 , pp. 377
    • Das, S.1
  • 12
    • 0343283999 scopus 로고    scopus 로고
    • note
    • A full-length mouse NMDAR1 cDNA was subcloned into the AAV plasmid from the parent plasmid, pSub201, under the control of a CMV immediate-early promoter and bovine growth hormone (bGH) polyadenylation site between the AAV inverted terminal repeats. Recombinant AAVNMDAR1 virus was generated helper-free as described (11).
  • 13
    • 0342414400 scopus 로고    scopus 로고
    • note
    • Eight months after vector administration, genomic DNA was extracted from gut, testes, spleen, and liver by standard methods. A 141-base pair (bp) product was amplified with DNA (200 ng), CMV primers (400 nmol), CMV-1 (5′ CCCAGTACATGACCTTATGGG 3′), and CMV-2 (5′ CCAGACTTGGAAATCCCCGT 3′). Analysis of β-actin genomic DNA was used to monitor DNA integrity, using primers β-A1 (5′ CTCTTC-CAGCCTTCCTTCC 3′) and β-A2 (5′ GTCACCTTCAC-CGTTCCAG 3′) to amplify a 772-bp band.
  • 14
    • 0342849307 scopus 로고    scopus 로고
    • note
    • Serum and antibodies were applied to nitrocellulose membranes for 1 hour at room temperature (RT ) or overnight (O/N) at 4°C following a 90-min incubation in 0.1% Tween 20 containing 5% fetal bovine serum (FBS) in Tris-buffered saline. Antibodies were visualized by incubation for 1 hour at RT with peroxidase-conjugated anti-rat or anti-mouse antibody (1:12,000, Sigma) and ECL detection (Amersham). Hippocampal and cortical extracts were prepared from naïve rat brain. Two preparations were used: (i) a crude hippocampal extract was prepared by homogenization in cold 320 mM sucrose in 10 mM Tris-HCl (pH 7.4); (ii) a nondenatured membrane extract was prepared similarly but in the presence of protease inhibitors (Mini Complete, Boehringer Mannheim). After centrifugation at 7000g for 10 min at 4°C, the resulting supernatant was centrifuged at 37,000g, for 40 min at 4°C and the pellet was resuspended in 10 mM Tris-HCl (pH 7.4) containing protease inhibitors. For serum and corresponding CSF antibody screening, extracts were separated and transferred to polyvinylidene difluoride membrane, and the ECL plus (Amersham) detection system was used.
  • 15
    • 0342849308 scopus 로고    scopus 로고
    • note
    • Ninety-six-well plates were coated with streptavidin (5 μg/ml at 37°C, O/N) followed by a 2-hour incubation with 1% FBS in 0.1%Tween 20 in PBS (PBST). Each peptide (1.2 nmol reconstituted in 0.2 ml dimethyl sulfoxide; Chiron Technologies, Clayton, Victoria, Australia) was diluted (1:1000 in PBST) before addition to the plates and incubation for 2 hours at RT. AAVNMDAR1, AAVlac, and naïve serum (1:200) were added and incubated at 4°C, O/N. Following a 1-hour incubation with peroxidase-conjugated antirat secondary antibody (1:40,000, RT), OPD substrate (Sigma) was applied and absorption at 490 nm was determined.
  • 16
    • 0028284469 scopus 로고
    • A. Kuryatov, B. Laube, H. Betz, J. Kuhse, Neuron 12, 1291 (1994); K. A. Wafford et al., Mol. Pharmacol. 47, 374 (1995); M. W. Wood, H. M. VanDongen, A. M. VanDongen, J. Biol. Chem. 272, 3532 (1997).
    • (1994) Neuron , vol.12 , pp. 1291
    • Kuryatov, A.1    Laube, B.2    Betz, H.3    Kuhse, J.4
  • 17
    • 0028921951 scopus 로고
    • A. Kuryatov, B. Laube, H. Betz, J. Kuhse, Neuron 12, 1291 (1994); K. A. Wafford et al., Mol. Pharmacol. 47, 374 (1995); M. W. Wood, H. M. VanDongen, A. M. VanDongen, J. Biol. Chem. 272, 3532 (1997).
    • (1995) Mol. Pharmacol. , vol.47 , pp. 374
    • Wafford, K.A.1
  • 18
    • 0031023519 scopus 로고    scopus 로고
    • A. Kuryatov, B. Laube, H. Betz, J. Kuhse, Neuron 12, 1291 (1994); K. A. Wafford et al., Mol. Pharmacol. 47, 374 (1995); M. W. Wood, H. M. VanDongen, A. M. VanDongen, J. Biol. Chem. 272, 3532 (1997).
    • (1997) J. Biol. Chem. , vol.272 , pp. 3532
    • Wood, M.W.1    Vandongen, H.M.2    Vandongen, A.M.3
  • 20
    • 0343283998 scopus 로고    scopus 로고
    • note
    • 3H]thymidine before harvesting onto filter mats and determination of thymidine incorporation.
  • 24
    • 0342849303 scopus 로고    scopus 로고
    • data not shown
    • M. J. During et al., data not shown.
    • During, M.J.1
  • 25
    • 0342849304 scopus 로고    scopus 로고
    • note
    • Animals were anesthetized with 60 mg/kg i.p. pentobarbital, and CSF (80 to 100 μl) was drawn from the cisterna magna using a 27-gauge needle. Rats were then left at least 7 days before kainate injection (10 mg/kg i.p) and CSF sampling under anesthesia 2 hours later.
  • 26
    • 0342414399 scopus 로고    scopus 로고
    • note
    • Naïve (n = 4), AAVlac (n = 4), AAVNMDAR1 (n = 4), and AAVNMDAR1 animals 2 hours after kainate administration (n = 2) were anesthetized before perfusion with 120 ml PBS. Anti-rat IgG immunohistochemistry (1:250, Sigma) was conducted on 16-μm hippocampal sections.
  • 27
    • 0029085707 scopus 로고
    • Endothelin-1 (60 pmol in 3 μl saline; Novabiochem) was injected via a 30-gauge cannula above the MCA (AP +0.2 mm, ML 5.9 mm, DV from dura 7.5 mm) of anesthetized animals [J. Sharkey and S. P. Butcher, J. Neurosci. Methods 60, 125 (1995)]. Coronal brain sections (20 μm) were taken for hematoxylin-eosin (HE) staining and isolectin B4 analysis. Infarct volume estimates were determined on serial HE sections using the Cavalieri method [H. Gundersen et al., APMIS 96, 857 (1988)].
    • (1995) J. Neurosci. Methods , vol.60 , pp. 125
    • Sharkey, J.1    Butcher, S.P.2
  • 28
    • 0023760665 scopus 로고
    • Endothelin-1 (60 pmol in 3 μl saline; Novabiochem) was injected via a 30-gauge cannula above the MCA (AP +0.2 mm, ML 5.9 mm, DV from dura 7.5 mm) of anesthetized animals [J. Sharkey and S. P. Butcher, J. Neurosci. Methods 60, 125 (1995)]. Coronal brain sections (20 μm) were taken for hematoxylin-eosin (HE) staining and isolectin B4 analysis. Infarct volume estimates were determined on serial HE sections using the Cavalieri method [H. Gundersen et al., APMIS 96, 857 (1988)].
    • (1988) APMIS , vol.96 , pp. 857
    • Gundersen, H.1
  • 30
    • 0025085616 scopus 로고
    • M. Carlssori and A. Svensson, Life Sci. 47, 1729 (1990); D. F. Wozniak, J. W. Olney, L. Kettinger, M. Price, J. P. Miller, Psychopharmacology 101, 47 (1990).
    • (1990) Life Sci. , vol.47 , pp. 1729
    • Carlssori, M.1    Svensson, A.2
  • 34
    • 0033536163 scopus 로고    scopus 로고
    • D. Schenk et al., Nature 400, 173 (1999).
    • (1999) Nature , vol.400 , pp. 173
    • Schenk, D.1
  • 35
    • 0028095257 scopus 로고
    • S. W. Rogers et al., Science 265, 648 (1994).
    • (1994) Science , vol.265 , pp. 648
    • Rogers, S.W.1
  • 46
    • 0343719508 scopus 로고    scopus 로고
    • in preparation
    • M. J. During et al., in preparation.
    • During, M.J.1
  • 47
    • 0342849302 scopus 로고    scopus 로고
    • note
    • We thank D. Wu, P. Schweder, J. Francis, S. McPhee, and R. Bland for general technical assistance and advice, C. G. Janson, J. Heywood, M. Dragunow, J. Fraser, and K. Lehnert for scientific assistance, helpful discussions, and manuscript review, T. Hughes for the NMDAR1 cDNA, and X. Xiao and R. J. Samulski for the original AAV cloning and packaging plasmids and advice regarding generation of recombinant AAV vectors. Supported in part by the New Zealand Marsden Fund, New Zealand Health Research Council, and the Jefferson Faculty Foundation.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.