메뉴 건너뛰기




Volumn 287, Issue 5457, 2000, Pages 1477-1479

Molecular architecture and evolution of a modular spider silk protein gene

Author keywords

[No Author keywords available]

Indexed keywords

BIOMATERIAL; M PROTEIN;

EID: 0034711997     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.287.5457.1477     Document Type: Article
Times cited : (262)

References (26)
  • 3
    • 0342414366 scopus 로고    scopus 로고
    • note
    • A λFixII (Stratagene) library of N.c. genomic DNA was a gift from M. Hinman. A λGem-12 (Promega) library was constructed from N.m. genomic DNA. Libraries were screened with the radiolabeled oligonucleotide CCWCCWGGWCCNNNWCCWCCWGGWCC (W = A or T; N = A, G, C, or T). Flag inserts were subcloned into pGEM (Promega) vectors and sequenced in both directions with universal or gene-specific primers. To sequence through long, highly repetitive regions, sets of nested deletions were created with the Erase-A-Base kit (Promega), or transposons were inserted using the Genome Priming System (New England Biolabs). An additional 2.8 kb of the Flag gene from N.c. was amplified by polymerase chain reaction with the primers CGCTTCTGAAACGAAAAAGG and GCGAACATTCTTCCTACAGA, ligated into pGEM3z-f(+) (Promega) and duplicate clones were sequenced as described above.
  • 4
    • 0025008260 scopus 로고
    • M. Xu and R. Lewis, Proc. Natl. Acad. Sci. U.S.A. 87, 7120 (1990); M. Hinman and R. Lewis, J. Biol. Chem. 267, 19320 (1992); M. Colgin and R. Lewis, Protein Sci. 7, 667 (1998).
    • (1990) Proc. Natl. Acad. Sci. U.S.A. , vol.87 , pp. 7120
    • Xu, M.1    Lewis, R.2
  • 5
    • 0026657815 scopus 로고
    • M. Xu and R. Lewis, Proc. Natl. Acad. Sci. U.S.A. 87, 7120 (1990); M. Hinman and R. Lewis, J. Biol. Chem. 267, 19320 (1992); M. Colgin and R. Lewis, Protein Sci. 7, 667 (1998).
    • (1992) J. Biol. Chem. , vol.267 , pp. 19320
    • Hinman, M.1    Lewis, R.2
  • 6
    • 0031932874 scopus 로고    scopus 로고
    • M. Xu and R. Lewis, Proc. Natl. Acad. Sci. U.S.A. 87, 7120 (1990); M. Hinman and R. Lewis, J. Biol. Chem. 267, 19320 (1992); M. Colgin and R. Lewis, Protein Sci. 7, 667 (1998).
    • (1998) Protein Sci. , vol.7 , pp. 667
    • Colgin, M.1    Lewis, R.2
  • 8
    • 0342414365 scopus 로고    scopus 로고
    • note
    • Flag gene exons and introns can be distinguished by several criteria. First, five exons directly correspond to the partial cDNAs Flag5' (GenBank accession no. AF027972) and Flag3' (GenBank accession no. AF027973). Second, all introns are flanked by the typical GT and AC boundary sequences. Third, exons could be continuously translated in only one reading frame, whereas introns could not be translated for any appreciable length in any reading frame. cDNA data (2) were used in analyses for N.c. exons 1 and 12.
  • 9
    • 0039174046 scopus 로고
    • E. Zimmer, S. Martin, S. Beverly, Y. Kan, A. Wilson, Proc. Natl. Acad. Sci. U.S.A. 77, 2158 (1980). Conservation of 5′ and 3′ terminal members of the repeated exons is consistent with some genetic models [M. Lassner and J. Dvorak, Nucleic Acids Res. 14, 5499 (1986)].
    • (1980) Proc. Natl. Acad. Sci. U.S.A. , vol.77 , pp. 2158
    • Zimmer, E.1    Martin, S.2    Beverly, S.3    Kan, Y.4    Wilson, A.5
  • 10
    • 0023046875 scopus 로고
    • E. Zimmer, S. Martin, S. Beverly, Y. Kan, A. Wilson, Proc. Natl. Acad. Sci. U.S.A. 77, 2158 (1980). Conservation of 5′ and 3′ terminal members of the repeated exons is consistent with some genetic models [M. Lassner and J. Dvorak, Nucleic Acids Res. 14, 5499 (1986)].
    • (1986) Nucleic Acids Res. , vol.14 , pp. 5499
    • Lassner, M.1    Dvorak, J.2
  • 11
    • 0343719467 scopus 로고    scopus 로고
    • note
    • The only exceptions are introns 3 and 4 of N.m. These introns have areas of high similarity to the other introns but also contain divergent regions that are difficult to align. Phylogenetic analysis and pairwise distances show that these introns are more similar to each other than to any of the other repeated introns (Fig. 3B). Despite their divergent sequences, these two introns are more similar to the other N.m. introns than to the N.c. introns. Introns 3 and 4 in N.m. are less homogenized than in N.c., so the degree of homogenization differs between species.
  • 15
    • 0020478245 scopus 로고
    • G. Dover, Nature 299, 111 (1982); C. Dover, A. Linares, T. Bowen, J. Hancock, Methods Enzymol. 224, 525 (1993).
    • (1982) Nature , vol.299 , pp. 111
    • Dover, G.1
  • 17
    • 0002999901 scopus 로고
    • F. Vollrath, Sci. Am. 266 (3), 70 (1992); S. Osaki, Nature 384, 419 (1996); F. Vollrath, Int. J. Biol. Macromol. 24, 81 (1999).
    • (1992) Sci. Am. , vol.266 , Issue.3 , pp. 70
    • Vollrath, F.1
  • 18
    • 16144362511 scopus 로고    scopus 로고
    • F. Vollrath, Sci. Am. 266 (3), 70 (1992); S. Osaki, Nature 384, 419 (1996); F. Vollrath, Int. J. Biol. Macromol. 24, 81 (1999).
    • (1996) Nature , vol.384 , pp. 419
    • Osaki, S.1
  • 19
    • 0032941532 scopus 로고    scopus 로고
    • F. Vollrath, Sci. Am. 266 (3), 70 (1992); S. Osaki, Nature 384, 419 (1996); F. Vollrath, Int. J. Biol. Macromol. 24, 81 (1999).
    • (1999) Int. J. Biol. Macromol. , vol.24 , pp. 81
    • Vollrath, F.1
  • 20
    • 0343719465 scopus 로고    scopus 로고
    • note
    • Multiple alignments were constructed with MALIGN, v.2.1 [W. Wheeler and D. Gladstein (American Museum of Natural History, New York, 1994)] and adjusted with SeqApp, v.1.9a [D. Gilbert (University of Indiana, Bloomington, 1992)] to consolidate gaps and maintain reading frames of the exons. Gaps are shown as dashes, missing data are indicated by question marks, and periods show identity to the initial sequence.
  • 21
    • 0004248459 scopus 로고
    • v. 3.1.1. Illinois Natural History Survey, Champaign, IL
    • D. Swofford, PAUP: Phytogenetic Analysis using Parsimony, v. 3.1.1. (Illinois Natural History Survey, Champaign, IL, 1993). Gaps were treated as a fifth character state. We do not consider individual exons or introns to be evolving independently and thus do not interpret parsimony trees as representing the phylogeny of the exons or introns.
    • (1993) PAUP: Phytogenetic Analysis Using Parsimony
    • Swofford, D.1
  • 25
    • 0342414362 scopus 로고    scopus 로고
    • v.6.5. Oxford Molecular Group, Oxford
    • Pairwise alignments were constructed with the Clustal W option with a gap weight of five in MacVector, v.6.5. (Oxford Molecular Group, Oxford, 1998).
    • (1998) MacVector
  • 26
    • 0342414361 scopus 로고    scopus 로고
    • note
    • Supported by grants from NSF (BIR-9510799, MCB-9806999) and the Army Research Office (DAAH04-95-1-0531, DAAG55-98-1-0262). We thank M. Hinman for the N.c. λ library and A. de Queiroz, J. Gatesy, S. Gatesy, and anonymous reviewers for improving the manuscript.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.