Broadly protective vaccine for Staphylococcus aureus based on an in vivo-expressed antigen

Science

Volumn 284, Issue 5419, 1999, Pages 1523-1527

  McKenney, David ^a   Pouliot, Kimberly L ^a   Wang, Ying ^a   Murthy, Vivek ^a   Ulrich, Martina ^b   Döring, Gerd ^b   Lee, Jean C ^a   Goldmann, Donald A ^c   Pier, Gerald B ^a  

^a BRIGHAM AND WOMEN S HOSPITAL   (United States)

^b UNIVERSITY HOSPITAL TÜBINGEN   (Germany)

^c BOSTON CHILDREN S HOSPITAL   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

GLUCOSAMINE DERIVATIVE; POLY N SUCCINYL BETA 1-6 GLUCOSAMINE; STAPHYLOCOCCUS VACCINE; UNCLASSIFIED DRUG;

ANIMAL EXPERIMENT; ANIMAL MODEL; ANIMAL TISSUE; ANTIBODY RESPONSE; ANTIGEN EXPRESSION; ARTICLE; BACTERIAL GENE; CONTROLLED STUDY; CYSTIC FIBROSIS; HUMAN; HUMAN TISSUE; KIDNEY INFECTION; MOUSE; NONHUMAN; PRIORITY JOURNAL; STAPHYLOCOCCUS AUREUS; STAPHYLOCOCCUS INFECTION; STRAIN DIFFERENCE; VACCINE PRODUCTION;

ANIMALS; ANTIBODIES, BACTERIAL; BACTERIAL CAPSULES; CHILD; FEMALE; GENES, BACTERIAL; HUMANS; IMMUNIZATION, PASSIVE; IMMUNOGLOBULIN G; KIDNEY; KIDNEY DISEASES; MICE; POLYSACCHARIDES, BACTERIAL; RABBITS; STAPHYLOCOCCAL INFECTIONS; STAPHYLOCOCCAL VACCINES; STAPHYLOCOCCUS AUREUS; VACCINATION;

EID: 0033612332     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.284.5419.1523     Document Type: Article

References (53)

1. A report from the National Nosocomial Infection Surveillance System, Am. J. Infect. Control. 25, 477 (1997); G. L. Archer, Clin. Infect. Dis. 26, 1179 (1998); F. D. Lowy, N. Engl. J. Med. 339, 520 (1998).
2. A report from the National Nosocomial Infection Surveillance System, Am. J. Infect. Control. 25, 477 (1997); G. L. Archer, Clin. Infect. Dis. 26, 1179 (1998); F. D. Lowy, N. Engl. J. Med. 339, 520 (1998).
3. A report from the National Nosocomial Infection Surveillance System, Am. J. Infect. Control. 25, 477 (1997); G. L. Archer, Clin. Infect. Dis. 26, 1179 (1998); F. D. Lowy, N. Engl. J. Med. 339, 520 (1998).
4. H. Miles, W. Lesser, P. Sears, J. Dairy Sci. 75, 596 (1992); S. C. Nickerson, W. E. Owens, R. L. Boddie, ibid. 78, 1607 (1995).
5. H. Miles, W. Lesser, P. Sears, J. Dairy Sci. 75, 596 (1992); S. C. Nickerson, W. E. Owens, R. L. Boddie, ibid. 78, 1607 (1995).
6. F. C. Tenover et al., J. Clin. Microbiol. 36, 1020 (1998); K. Hiramatsu et al., Lancet 350, 1670 (1997); T. L. Smith et al., N. Engl. J. Med. 340, 493 (1999).
7. F. C. Tenover et al., J. Clin. Microbiol. 36, 1020 (1998); K. Hiramatsu et al., Lancet 350, 1670 (1997); T. L. Smith et al., N. Engl. J. Med. 340, 493 (1999).
8. F. C. Tenover et al., J. Clin. Microbiol. 36, 1020 (1998); K. Hiramatsu et al., Lancet 350, 1670 (1997); T. L. Smith et al., N. Engl. J. Med. 340, 493 (1999).
9. M. J. Mahan, J. M. Slauch, J. J. Mekalanos, Science 259, 686 (1993); J. M. Slauch, M. J. Mahan, J. J. Mekalanos, Methods Enzymol. 235, 481 (1994); M. J. Mahan et al., Proc. Natl. Acad. Sci. U.S.A. 92, 669 (1995); M. Hensel et al., Science 269, 400 (1995).
10. M. J. Mahan, J. M. Slauch, J. J. Mekalanos, Science 259, 686 (1993); J. M. Slauch, M. J. Mahan, J. J. Mekalanos, Methods Enzymol. 235, 481 (1994); M. J. Mahan et al., Proc. Natl. Acad. Sci. U.S.A. 92, 669 (1995); M. Hensel et al., Science 269, 400 (1995).
11. M. J. Mahan, J. M. Slauch, J. J. Mekalanos, Science 259, 686 (1993); J. M. Slauch, M. J. Mahan, J. J. Mekalanos, Methods Enzymol. 235, 481 (1994); M. J. Mahan et al., Proc. Natl. Acad. Sci. U.S.A. 92, 669 (1995); M. Hensel et al., Science 269, 400 (1995).
12. M. J. Mahan, J. M. Slauch, J. J. Mekalanos, Science 259, 686 (1993); J. M. Slauch, M. J. Mahan, J. J. Mekalanos, Methods Enzymol. 235, 481 (1994); M. J. Mahan et al., Proc. Natl. Acad. Sci. U.S.A. 92, 669 (1995); M. Hensel et al., Science 269, 400 (1995).
13. D. McKenney et al., Infect. Immun. 66, 4711 (1998).
14. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
15. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
16. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
17. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
18. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
19. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
20. J. C. Lee et al., ibid. 55, 2191 (1987); M. Moreau et al., Carbohydr. Res. 201, 285 (1990); W. W. Karakawa et al., J. Clin. Microbiol. 22, 445 (1985); D. Sompolinsky et al., ibid., p. 828; J. M. Fournier, W. F. Vann, W. W. Karakawa, Infect. Immun. 45, 87 (1984); S. V. Murthy et al., Carbohydr. Res. 117, 113 (1983); T. E. West, B. A. Lewis, M. A. Apicella, J. Gen. Microbiol. 133, 431 (1987).
21. Bacterial pellets from sputum samples from nine CF patients chronically infected with S. aureus were dried on cover slips and fixed with 10% formaldehyde for 30 min at room temperature and then processed as described for immunofluorescence (27), except that a fluorescein isothiocyanate (FITC)-conjugated swine antibody to rabbit IgG (diluted 1:40) was used to visualize PNSG. Cover slips were mounted with Permafluor and analyzed with a fluorescence microscope as described (9). Each sputum sample was analyzed twice.
22. D. McKenney et. al., unpublished data.
23. S. Herbert et al., J. Infect. Dis. 176, 431 (1997).
24. J. C. Lee et al., J. Clin. Microbiol. 28, 2612 (1990).
25. For detection of PNSG expression by fresh clinical isolates, we used a sensitive ELISA inhibition that was slightly modified from the previously described procedure (5), as well as immunoelectron microscopy (5). Bacterial cells were suspended to an optical density at 650 nm of 2.0 in 0.1 M phosphate and 0.15 M NaCl [phosphate-buffered saline (PBS)] and then treated with trypsin (0.65 mg/ml for 30 min at 37°C) to destroy antibody-binding structures such as protein A present on the surface of most S. aureus strains [B. F. King and B. J. Witkinson, Infect. Immun. 33, 666 (1981)]. After washing, the bacterial pellet was suspended in a 1:500 dilution of antiserum to PNSG and incubated at 4°C overnight, after which cells were removed and adsorbed sera were tested for residual binding activity in a PNSG-specific ELISA as described (5).
26. C. Heilmann et al., Mol. Microbiol. 20, 1083 (1996); C. Gerke et al., J. Biol. Chem. 273, 18586 (1998).
27. C. Heilmann et al., Mol. Microbiol. 20, 1083 (1996); C. Gerke et al., J. Biol. Chem. 273, 18586 (1998).
28. Primers were designed to amplify a gene product of 2.7 kb encompassing a region of the icaADBC genes of the staphylococcal ica locus (12). The PCR forward primer was TGCACTCAATGAGGGAATCA, corresponding to nucleotides 409 to 428 in the icaA gene; the reverse primer was AATCACTACCGGAAACAGCG, complementary to nucleotides 3114 to 3133 in the icaC gene. PCR was carried out with Platinum PCR Supermix and 200 nM primers. DNA melting was at 95°C for 30 s, annealing was at 60°C for 60 s, and elongation was at 72°C for 60 s; repeat cycles decreased the annealing temperature by 0.5°C each cycle until 28 cycles were completed. Amplified DNA was visualized after separation in a 0.7% agarose gel and staining with ethidium bromide.
29. With the use of the blastN and blastT search programs [S. F. Altschul et al., J. Mol. Biol. 215, 403 (1990)] on the unfinished nucleotide sequences of the S. aureus NCTC 8325-4 genome (University of Oklahoma's Advanced Center for Genome Technology) and the S. aureus COL genome (Institute for Genome Research), there was 71 and 74% identity, respectively, with the ica locus of S. epidermidis RP62A (accession number U43366). The predicted protein sequences from S. aureus shared 72% identity and 80% (NCTC 8325-4) and 87% (COL) similarity to the S. epidermidis icaADBC proteins. The matches were on three unassembled fragments (contigs 1441, 1348, and 1147) of the NCTC 8325-4 genome sequence and in the proper order on a single fragment (gsa-76) of 9459 base pairs of the COL genome sequence. The GCG suite of programs (Wisconsin Package 9.1; Genetics Computer Group, Madison WI) was used to assemble the fragments of the S. aureus NCTC 8325-4 genome for translation and analysis.
30. Y. Wang and R. I. Hollingsworth, Carbohydr. Res. 260, 305 (1994).
31. Swiss Webster mice were actively immunized IP with three 100-μg doses of PNSG 5 to 6 days apart or identically with a control polysaccharide antigen from P. aeruginosa. Five days after the last dose, the mice were challenged with S. aureus, and infection was allowed to proceed for 5 days, after which the mice were killed and bacterial counts on kidney homogenates were performed. The significance of the differences in CFU per gram of kidney between PNSG-immune and control mice was determined by a t test. All mice were treated in accordance with institutional guidelines for the humane care and treatment of animals.
32. J. C. Lee and G. B. Pier, in The Staphylococci in Human Disease, K. Crossley and G. L. Archer, Eds. (Churchill Livingstone, New York, 1997), pp. 631-654.
33. A. I. Fattom et al., Infect. Immun. 64, 1659 (1996).
34. Three examples are shown of eight tested, representative of five PNSG-negative, two PNSG-low, and one PNSG-intermediate strain at challenge. Baseline values for percentage of inhibition of antibody binding ± the standard error for S. aureus are as follows: strain Por = 0 ± 9%, strain 5836 = 21 ± 4%, and strain 5827 = 48 ± 5%.
35. W. R. Schwan et al., Infect Immun 66, 567 (1998); A. M. Lowe, D. T. Beattie, R. L. Deresiewicz, Mol. Microbiol. 27, 967 (1998); J. M. Mei, F. Nourbakhsh, C. W. Ford, D. W. Holden, ibid. 26, 399 (1997).
36. W. R. Schwan et al., Infect Immun 66, 567 (1998); A. M. Lowe, D. T. Beattie, R. L. Deresiewicz, Mol. Microbiol. 27, 967 (1998); J. M. Mei, F. Nourbakhsh, C. W. Ford, D. W. Holden, ibid. 26, 399 (1997).
37. W. R. Schwan et al., Infect Immun 66, 567 (1998); A. M. Lowe, D. T. Beattie, R. L. Deresiewicz, Mol. Microbiol. 27, 967 (1998); J. M. Mei, F. Nourbakhsh, C. W. Ford, D. W. Holden, ibid. 26, 399 (1997).
38. H. Shiro, et al., Circulation 92, 2715 (1995).
39. A. Fattom et al., Infect. Immun. 61, 1023 (1993); A. Fattom et al., ibid. 60, 584 (1992); J. C. Lee et al., ibid. 65, 4146 (1997).
40. A. Fattom et al., Infect. Immun. 61, 1023 (1993); A. Fattom et al., ibid. 60, 584 (1992); J. C. Lee et al., ibid. 65, 4146 (1997).
41. A. Fattom et al., Infect. Immun. 61, 1023 (1993); A. Fattom et al., ibid. 60, 584 (1992); J. C. Lee et al., ibid. 65, 4146 (1997).
42. N. Balaban et al., Science 280, 438 (1998).
43. W. Mamo, M. Boden, J. I. Flock, FEMS Immunol. Med. Microbiol. 10, 47 (1994); T. Schennings et al., Microb. Pathog. 15, 227 (1993); I. M. Nilsson et al., J. Clin. Invest. 101, 2640 (1998).
44. W. Mamo, M. Boden, J. I. Flock, FEMS Immunol. Med. Microbiol. 10, 47 (1994); T. Schennings et al., Microb. Pathog. 15, 227 (1993); I. M. Nilsson et al., J. Clin. Invest. 101, 2640 (1998).
45. W. Mamo, M. Boden, J. I. Flock, FEMS Immunol. Med. Microbiol. 10, 47 (1994); T. Schennings et al., Microb. Pathog. 15, 227 (1993); I. M. Nilsson et al., J. Clin. Invest. 101, 2640 (1998).
46. E. Muller et al., J. Infect. Dis. 168, 1211 (1993); W. Ziebuhr et al., Infect. Immun. 65, 890 (1997).
47. E. Muller et al., J. Infect. Dis. 168, 1211 (1993); W. Ziebuhr et al., Infect. Immun. 65, 890 (1997).
48. S. Takeda et al., Circulation 84, 2539 (1991); Y. Kojima et al., J. Infect. Dis. 162, 435 (1990).
49. S. Takeda et al., Circulation 84, 2539 (1991); Y. Kojima et al., J. Infect. Dis. 162, 435 (1990).
50. For characterization of PNSG production in S. aureus-infected lungs, bronchial tissue pieces (2 mm by 2 mm) from right upper lobes of two 8-year-old female CF patients who underwent lobectomy because of chronic S. aureus infection were embedded in agarose and thereafter in K11M for sectioning. Ultrathin sections (0.1 to 0.2 μm) were fixed on glass slides, and nonspecific binding of antibodies to Protein A was blocked with swine serum diluted 1:10 in PBS (pH 7.4) supplemented with 0.1% Tween 20 for 1 hour at room temperature. After washing with PBS-Tween 20, sections were incubated with rabbit antibody to S. aureus PNSG for 1 hour at room temperature in a wet chamber, followed by incubation with a mouse monoclonal IgG antibody to the CP5 or CP8 antigen of S. aureus for 1 hour, and then washed with PBS-Tween 20. For detection of PNSG expression, sections were incubated for 40 min with CY3-indocarbocyanine-conjugated antibody to rabbit IgG diluted 1:500 in PBS-Tween 20. For detection of CP antigens, sections were incubated with FITC-conjugated antibody to mouse IgG diluted 1:200 in PBS-Tween 20. After washing, DNA was stained with 1 μg of 4′,6-diamidino-2-phenylindole, dilactate (DAPI) per milliliter for 5 min, and sections were washed again with distilled water; the sections were embedded in Permafluor and analyzed with a fluorescence microscope (9).
51. PNSG was used to immunize rabbits to obtain specific antibodies. After an antibody titer >1000 was detected by ELISA, immune rabbit sera were used for protection studies in the mouse renal abscess model [A. Albus, R. D. Arbeit, J. C. Lee, Infect. Immun. 59, 1008 (1991)]. Control sera were from rabbits immunized with the irrelevant P. aeruginosa polysaccharide. Six-to eight-week-old Swiss Webster mice were treated with 0.5 ml of rabbit serum IP 4 hours before challenge with S. aureus strains and again 18 hours later. Infection was allowed to proceed for 5 days, after which the mice were killed and bacteria were counted in kidney homogenates (16).
52. Staphylococcus aureus cells growing on primary cultures from infected mouse kidneys were scraped directly from TSA plates into PBS. A 1-ml volume of the cells was centrifuged (15,000g, 5 min), washed in sterile PBS, and treated with trypsin (0.65 mg/ml for 30 min at 37°C). Electron microscopic grids were prepared and processed for viewing as described (5). The grids were examined with a transmission electron microscope at magnifications of 6000 to 25,000.
53. We thank J. Hübner and E. Muller for helpful input, F. Tenpver for MRSA-VISA strains, A. Onderdonk for clinical isolates, R. Ross for S. aureus strain MN8m, L. Almeida for assistance with colony immunoblots, A. Fattom for human antibodies to CP5 and CP8, M. Coyne for assistance with analysis of S. aureus genome sequences, J. M. Fournier for monoclonal antibodies to CP5 and CP8, S. Campana and L Marianelli for supplying CF sputum samples, and G. Bellon for CF lung tissue. Supported by NIH grant Al23335.