메뉴 건너뛰기




Volumn 286, Issue 5442, 1999, Pages 1180-1184

Calmodulin dependence of presynaptic metabotropic glutamate receptor signaling

Author keywords

[No Author keywords available]

Indexed keywords

CALMODULIN; GUANINE NUCLEOTIDE BINDING PROTEIN; METABOTROPIC RECEPTOR; PRESYNAPTIC RECEPTOR;

EID: 0033527687     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.286.5442.1180     Document Type: Article
Times cited : (139)

References (41)
  • 3
  • 6
    • 0029921401 scopus 로고    scopus 로고
    • S. R. Ikeda, Nature 380, 255 (1996); 5. Herlitze et al., ibid., p. 258.
    • (1996) Nature , vol.380 , pp. 255
    • Ikeda, S.R.1
  • 7
    • 0029921401 scopus 로고    scopus 로고
    • S. R. Ikeda, Nature 380, 255 (1996); S. Herlitze et al., ibid., p. 258.
    • Nature , pp. 258
    • Herlitze, S.1
  • 8
    • 0029973079 scopus 로고    scopus 로고
    • R. Shigemoto et al., ibid. 381, 523 (1996); R. Shigemoto et al., J. Neurosci. 17, 7503 (1997).
    • (1996) Nature , vol.381 , pp. 523
    • Shigemoto, R.1
  • 9
    • 0030821474 scopus 로고    scopus 로고
    • R. Shigemoto et al., ibid. 381, 523 (1996); R. Shigemoto et al., J. Neurosci. 17, 7503 (1997).
    • (1997) J. Neurosci. , vol.17 , pp. 7503
    • Shigemoto, R.1
  • 11
    • 0027955170 scopus 로고
    • To generate sequences encoding the COOH-terminal region of mGluR 7 [N. Okamoto et al., J. Biol. Chem. 269, 1231 (1994)], we used oligonucleotides complementary to the codons of amino acids 851 to 857 (HPELNVQ; gagattccaccctgaactcaatgtccag) and 910 to 916 (YNNLVIstop; ctgtcgacttagataaccaggttattata) in a standard PCR on mouse brain cDNA at annealing temperatures of 52°C (26). This generated two products corresponding to cDNAs encoding the known COOH-terminal region of mGluR 7 (mGluR 7A) and a recently reported splice variant [P. J. Flor et al., Neuropharmacology 36, 153 (1997)] containing an additional 81-base pair insertion (mGluR 7B). Full-length mGluR 7A-ΔCaM and truncated mGluR 7A tail sequences were also generated by PCR using a similar procedure. All amplification products were verified by automated DNA sequencing.
    • (1994) J. Biol. Chem. , vol.269 , pp. 1231
    • Okamoto, N.1
  • 12
    • 0030996238 scopus 로고    scopus 로고
    • To generate sequences encoding the COOH-terminal region of mGluR 7 [N. Okamoto et al., J. Biol. Chem. 269, 1231 (1994)], we used oligonucleotides complementary to the codons of amino acids 851 to 857 (HPELNVQ; gagattccaccctgaactcaatgtccag) and 910 to 916 (YNNLVIstop; ctgtcgacttagataaccaggttattata) in a standard PCR on mouse brain cDNA at annealing temperatures of 52°C (26). This generated two products corresponding to cDNAs encoding the known COOH-terminal region of mGluR 7 (mGluR 7A) and a recently reported splice variant [P. J. Flor et al., Neuropharmacology 36, 153 (1997)] containing an additional 81-base pair insertion (mGluR 7B). Full-length mGluR 7A-ΔCaM and truncated mGluR 7A tail sequences were also generated by PCR using a similar procedure. All amplification products were verified by automated DNA sequencing.
    • (1997) Neuropharmacology , vol.36 , pp. 153
    • Flor, P.J.1
  • 16
    • 0345332319 scopus 로고    scopus 로고
    • Affinity measurements were done by fluorescence spectroscopy using dansylated calmodulin
    • Affinity measurements were done by fluorescence spectroscopy using dansylated calmodulin.
  • 20
    • 0345332316 scopus 로고    scopus 로고
    • unpublished data
    • V. O'Connor, unpublished data.
    • O'Connor, V.1
  • 21
    • 0028600610 scopus 로고
    • 2+ did not affect the binding of Gβγ to GST-7A. After repeated washing, bound proteins were eluted with 30 mM glutathione or SDS sample buffer. Immunoblots were done with antiserum 7 (Gβ-common) or antiserum 11 (Gα-common) (29).
    • (1994) J. Biol. Chem. , vol.269 , pp. 32077
    • Jockers, R.1
  • 22
    • 0028142193 scopus 로고
    • 2+ did not affect the binding of Gβγ to GST-7A. After repeated washing, bound proteins were eluted with 30 mM glutathione or SDS sample buffer. Immunoblots were done with antiserum 7 (Gβ-common) or antiserum 11 (Gα-common) (29).
    • (1994) Methods Enzymol. , vol.327 , pp. 254
    • Mumby, S.M.1    Linder, M.E.2
  • 23
    • 0345332315 scopus 로고    scopus 로고
    • 2+ did not affect the binding of Gβγ to GST-7A. After repeated washing, bound proteins were eluted with 30 mM glutathione or SDS sample buffer. Immunoblots were done with antiserum 7 (Gβ-common) or antiserum 11 (Gα-common) (29)
    • 2+ did not affect the binding of Gβγ to GST-7A. After repeated washing, bound proteins were eluted with 30 mM glutathione or SDS sample buffer. Immunoblots were done with antiserum 7 (Gβ-common) or antiserum 11 (Gα-common) (29).
  • 26
    • 0025788797 scopus 로고
    • 2, 20 mM glucose, and 10 mM Hepes, adjusted to pH 7.4 with NaOH. Drug application was performed as described (20). Postsynaptic glutamate responses were elicited by the direct application of 100 μM glutamate
    • 2, 20 mM glucose, and 10 mM Hepes, adjusted to pH 7.4 with NaOH. Drug application was performed as described (20). Postsynaptic glutamate responses were elicited by the direct application of 100 μM glutamate.
    • (1991) Proc. Natl. Acad. Sci. U.S.A. , vol.88 , pp. 7834
    • Bekkers, J.M.1    Stevens, C.F.2
  • 28
    • 0344901257 scopus 로고    scopus 로고
    • data not shown
    • S. Boehm, data not shown.
    • Boehm, S.1
  • 35
    • 0345332307 scopus 로고    scopus 로고
    • unpublished data
    • O. El Far, unpublished data.
    • El Far, O.1
  • 38
    • 0032189766 scopus 로고    scopus 로고
    • X. M. Xia et al., Nature 395, 503 (1998).
    • (1998) Nature , vol.395 , pp. 503
    • Xia, X.M.1
  • 39
    • 0033551361 scopus 로고    scopus 로고
    • A. Lee et al., Nature 399, 155 (1999).
    • (1999) Nature , vol.399 , pp. 155
    • Lee, A.1
  • 41
    • 0344038417 scopus 로고    scopus 로고
    • Supported by Deutsche Forschungsgemeinschaft (H.B.), Fonds der Chemischen Industrie (H.B.), the Human Frontier Science Program Organization (HFSPO; H.B.), and the Austrian Science Foundation (S.B., M.F., and C.N.). O.E.F. was supported by a HFSPO postdoctoral fellowship, and E.B.C. by a grant from the European Community
    • We thank R. Shigemoto for mGluR 7A antisera, S. Nakanishi for cDNA, A. Niehuis, A. Motejlek, and E. Wischmeyer for experimental assistance, and M. Baier and M. Reitz for secretarial help. Supported by Deutsche Forschungsgemeinschaft (H.B.), Fonds der Chemischen Industrie (H.B.), the Human Frontier Science Program Organization (HFSPO; H.B.), and the Austrian Science Foundation (S.B., M.F., and C.N.). O.E.F. was supported by a HFSPO postdoctoral fellowship, and E.B.C. by a grant from the European Community.
    • Shigemoto, R.1    Nakanishi, S.2    Niehuis, A.3    Motejlek, A.4    Wischmeyer, E.5    Baier, M.6    Reitz, M.7


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.