RasGRP, a Ras guanyl nucleotide- releasing protein with calcium- and diacylglycerol-binding motifs

Science

Volumn 280, Issue 5366, 1998, Pages 1082-1086

  Ebinu, Julius O ^a   Bottorff, Drell A ^a   Chan, Edmond Y W ^a   Stang, Stacey L ^a   Dunn, Robert J ^a   Stone, James C ^a  

^a NONE

Author keywords

[No Author keywords available]

Indexed keywords

CALCIUM ION; DIACYLGLYCEROL; GUANINE NUCLEOTIDE BINDING PROTEIN; RAS PROTEIN;

ARTICLE; BINDING AFFINITY; CELL TRANSFORMATION; FIBROBLAST; HUMAN; HUMAN CELL; ONCOGENE RAS; PARTITION CHROMATOGRAPHY; PRIORITY JOURNAL; PROTEIN ANALYSIS; PROTEIN DOMAIN; PROTEIN EXPRESSION;

AMINO ACID SEQUENCE; ANIMALS; BRAIN; CA(2+)-CALMODULIN DEPENDENT PROTEIN KINASE; CALCIUM; CATALYSIS; CELL CYCLE PROTEINS; CELL LINE; CELL MEMBRANE; CELL SIZE; CELL TRANSFORMATION, NEOPLASTIC; CLONING, MOLECULAR; DIGLYCERIDES; DNA, COMPLEMENTARY; DNA-BINDING PROTEINS; GENES, RAS; GUANINE NUCLEOTIDE EXCHANGE FACTORS; GUANOSINE DIPHOSPHATE; GUANOSINE TRIPHOSPHATE; MOLECULAR SEQUENCE DATA; NEURONS; PHOSPHOPROTEIN PHOSPHATASE; RAS PROTEINS; RAS-GRF1; RATS; RECOMBINANT FUSION PROTEINS; SIGNAL TRANSDUCTION;

EID: 0032524389     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.280.5366.1082     Document Type: Article

References (50)

1. A. Ghosh and M. E. Greenberg, Science 268, 239 (1995).
2. 32 → Arg substitution) effector mutant using a helper-free, tk retrovirus vector (3). This mutation in v-H-ras is transformation-defective in rat2 cells, but it does transform the somatic mutant rv68BUR and has been used to select extragenic suppresser mutations in Mek1 (4). The encoded Ras protein interacts weakly with Raf in the yeast two-hybrid system [S. Stang et al., Mol. Cell. Biol. 17, 3047 (1997)]. Superinfection of Y32R-expressing rat2 cells with the viruses representing the cDNA library resulted in rare transformed foci. DNA extracted from focus-derived cell lines was used as a template in a PCR protocol, and recovered DNA fragments were cloned into pCTV3B, which expresses the selectable marker hygro. Individual plasmids were converted to virus form and tested for transformation. Transforming cDNAs were identified by sequence analysis.
3. 32 → Arg substitution) effector mutant using a helper-free, tk retrovirus vector (3). This mutation in v-H-ras is transformation-defective in rat2 cells, but it does transform the somatic mutant rv68BUR and has been used to select extragenic suppresser mutations in Mek1 (4). The encoded Ras protein interacts weakly with Raf in the yeast two-hybrid system [S. Stang et al., Mol. Cell. Biol. 17, 3047 (1997)]. Superinfection of Y32R-expressing rat2 cells with the viruses representing the cDNA library resulted in rare transformed foci. DNA extracted from focus-derived cell lines was used as a template in a PCR protocol, and recovered DNA fragments were cloned into pCTV3B, which expresses the selectable marker hygro. Individual plasmids were converted to virus form and tested for transformation. Transforming cDNAs were identified by sequence analysis.
4. 32 → Arg substitution) effector mutant using a helper-free, tk retrovirus vector (3). This mutation in v-H-ras is transformation-defective in rat2 cells, but it does transform the somatic mutant rv68BUR and has been used to select extragenic suppresser mutations in Mek1 (4). The encoded Ras protein interacts weakly with Raf in the yeast two-hybrid system [S. Stang et al., Mol. Cell. Biol. 17, 3047 (1997)]. Superinfection of Y32R-expressing rat2 cells with the viruses representing the cDNA library resulted in rare transformed foci. DNA extracted from focus-derived cell lines was used as a template in a PCR protocol, and recovered DNA fragments were cloned into pCTV3B, which expresses the selectable marker hygro. Individual plasmids were converted to virus form and tested for transformation. Transforming cDNAs were identified by sequence analysis.
5. J. C. Stone and R. Blanchard, Mol. Cell. Biol. 11, 6158 (1991).
6. D. Bottorff, S. Stang, S. Agellon, J. C. Stone, ibid. 15, 5113 (1995).
7. A rat brain cDNA library in a phage vector was screened with an rbc7 probe, and overlapping cDNA inserts representing the 5′ and 3′ ends of RasGRP were recovered. These inserts were sequenced to identify an in-frame initiator methionine preceded by a Kozak consensus sequence and the first downstream, in-frame stop codon. The entire sequence of RasGRP was verified by sequence analysis of a DNA fragment recovered from rat brain RNA with a reverse transcription PCR (Fig. 1).
8. D. Broek et al., Cell 48, 789 (1987).
9. C.-C. Lai, M. Boguski, D. Broek, S. Powers, Mol. Cell. Biol. 13, 1345 (1993).
10. C. Shou, C. L. Farnsworth, B. G. Neel, L. A. Feig, Nature 358, 351 (1992).
11. C. L. Farnsworth et al., ibid. 376, 524 (1995).
12. P. Chardin et al., Science 260, 1338 (1993); D. Bowtell, P. Fu, M. Simon, P. Senior, Proc. Natl. Acad. Sci. U.S.A. 89, 6511 (1992)
13. P. Chardin et al., Science 260, 1338 (1993); D. Bowtell, P. Fu, M. Simon, P. Senior, Proc. Natl. Acad. Sci. U.S.A. 89, 6511 (1992)
14. . 11. S. E. Egan and R. A. Weinberg, Nature 365, 781 (1993).
15. N. C. J. Strynadka and M. N. G. James, Annu. Rev. Biochem. 58, 951 (1989).
16. 2 was added to 20 mM. The values obtained with buffer represent the spontaneous dissociation-association reactions. For both guanyl nucleotide exchange assays, the results are representative of three experiments.
17. J. O. Ebinu and J. C. Stone, unpublished data.
18. E. Y. W. Chan and J. C. Stone, unpublished data.
19. - contains all eight substitutions. Coomassie blue staining of a parallel gel demonstrated that equivalent amounts of fusion protein of each genotype were expressed. The experiment was duplicated.
20. 3H]PDBu binding in the presence of phosphatidylserine was performed as described [Y. Tanaka, R. Miyake, U. Kikkawa, Y. Nishizuka, J. Biochem. 99, 257 (1986)]. The GST-DAG protein contains residues 538 to 598 of RasGRP. Mouse brain extracts, which contain substantial amounts of PKC, were used as a positive control. The experiment was duplicated.
21. For these studies, we used a modified version of the original cDNA, rbc7HA, cloned in the retrovirus vector pBabepuro [J. P. Morgenstern and H. Land, Nucleic Acids Res. 18, 3587 (1990)]. This modified sequence includes a synthetic Kozak consensus sequence and extends from the internal initiator methionine underlined in Fig. 1B to the premature stop codon. The sequence TATGATGTTCCTGATTATGCTAGCCTC was inserted immediately upstream of this stop codon. It encodes the HA ("Flu") epitope. rbc7 and rbc7HA are similar biologically.
22. 32Pi-labeling method. After treatment with PMA (100 nM for 2 min), cells were lysed, and Ras-GDP and Ras-GTP were immunoprecipitated with antibody Y13-259. Ras-associated guanyl nucleotides were then separated by chromatography and quantified by phosphorimager analysis [J. C. Stone, M. Colleton, D. Bottorff, Mol. Cell. Biol. 13, 7311 (1993)]. The bars in Fig. 3A represent the standard deviation of the mean of three separate experimental values. The amounts of Ras-GTP were compared in rat2 cells expressing the empty vector and rat cells expressing full-length RasGRP with a method that takes advantage of the ability of Ras-GTP to bind the Ras-binding domain of Raf [ S. Taylor and D. Shalloway, Curr. Biol. 6, 1621 (1996)]. Cells were treated with endothelin-1 (100 nM for 10 min) and then lysed. The amount of Ras that associated with either GST-Raf (Raf-binding domain) or GST (negative control) was determined by immunoblotting with an antibody to Ras. Lysates contained very similar amounts of Ras.
23. 32Pi-labeling method. After treatment with PMA (100 nM for 2 min), cells were lysed, and Ras-GDP and Ras-GTP were immunoprecipitated with antibody Y13-259. Ras-associated guanyl nucleotides were then separated by chromatography and quantified by phosphorimager analysis [J. C. Stone, M. Colleton, D. Bottorff, Mol. Cell. Biol. 13, 7311 (1993)]. The bars in Fig. 3A represent the standard deviation of the mean of three separate experimental values. The amounts of Ras-GTP were compared in rat2 cells expressing the empty vector and rat cells expressing full-length RasGRP with a method that takes advantage of the ability of Ras-GTP to bind the Ras-binding domain of Raf [ S. Taylor and D. Shalloway, Curr. Biol. 6, 1621 (1996)]. Cells were treated with endothelin-1 (100 nM for 10 min) and then lysed. The amount of Ras that associated with either GST-Raf (Raf-binding domain) or GST (negative control) was determined by immunoblotting with an antibody to Ras. Lysates contained very similar amounts of Ras.
24. H. Daub, F. U. Weiss, C. Wallasch, A. Ullrich, Nature 379, 557 (1996).
25. I. Ambar and M. Sokolovsky, Eur. J. Pharmacol. 245, 31 (1993).
26. W. Kolch et al., Nature 364, 249 (1993).
27. RNA was extracted from adult rat tissues with the Trizol method. Total RNA (10 μg) was resolved by electrophoresis in 1% agarose in borate buffer, blotted onto Hybond nylon membrane (Amersham), hybridized with RasGRP cDNA probe, and washed at high stringency.
28. 35S-labeled RNA probe consisting of bases 1831 to 2014 of RasGRP was used for hybridization, and the sections were dipped in NTB2 emulsion and exposed for 15 days. Control hybridizations to adjacent sections with a sense probe showed a low amount of diffuse, uniform labeling.
29. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
30. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
31. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
32. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
33. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
34. A. B. Vojtek, S. M. Hollenberg, J. A. Cooper, Cell 74, 205 (1993); L. Van Aelst, M. Barr, S. Marcus, A. Polverino, M. Wigler, Proc. Natl. Acad. Sci. U.S.A. 90, 6213 (1993) ; X. Zhang et al., Nature 364, 308 (1993); P. H. Warne, P. Rodriguez-Viciana, J. Downward, ibid., p. 352; P. Rodriguez-Viciana et al., ibid. 370, 527 (1994) ; P. Rodriguez-Viciana et al., Cell 89, 527 (1997).
35. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
36. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
37. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
38. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
39. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
40. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
41. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
42. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
43. G. D. Borasio et al., Neuron 2, 1087 (1989); G. D. Borasio et al., J. Cell Biol. 121, 665 (1993) ; M. Lohof, N. Y. Ip, M. Poo, Nature 363, 350 (1993); S. Cowley, H. Paterson, P. Kemp, C. J. Marshall, Cell 77, 841 (1994) ; H. Kang and E. M. Schuman, Science 267, 1658 (1995); C. D. Nobes, J. B. Reppas, A. Markus, A. M. Tolkovsky, Neuroscience 70, 1067 (1996) ; H. N. Marsh and H. C. Palfrey, J. Neurochem. 67, 952 (1996); K. C. Martin et al., Neuron 18, 899 (1997) ; R. Brambilla et al., Nature 390, 281 (1997).
44. H. Dudek et al., Science 275, 661 (1997).
45. M. J. Berridge, Nature 361, 315 (1993).
46. M. S. Boguski and F. McCormick, ibid. 366, 643 (1993).
47. A. Aitken, C. B. Klee, P. Cohen, Eur. J. Biochem. 139, 663 (1984).
48. J. P. Aris et al., Biochim. Biophys. Acta 1174, 171 (1993).
49. Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
50. We thank R. Kay for advice on cDNA cloning and L. Agellon, D. Brindley, N. Dower, M. James, D. Lowy, H. Ostergaard, E. Shibuya, and B. Sykes for useful discussions. Supported by grants to J.C.S. from the National Cancer Institute, Canada.