Control of filament formation in Candida albicans by the transcriptional repressor TUP1

Science

Volumn 277, Issue 5322, 1997, Pages 105-109

  Braun, Burkhard R ^a   Johnson, Alexander D ^a  

^a UNIVERSITY OF CALIFORNIA   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

REPRESSOR PROTEIN; REPRESSOR PROTEIN TUP 1; UNCLASSIFIED DRUG;

ARTICLE; CANDIDA ALBICANS; EPISTASIS; FUNGUS GROWTH; FUNGUS HYPHAE; GENE REPRESSION; NONHUMAN; PRIORITY JOURNAL;

AMINO ACID SEQUENCE; CANDIDA ALBICANS; CLONING, MOLECULAR; CULTURE MEDIA; DNA-BINDING PROTEINS; EPISTASIS, GENETIC; FUNGAL PROTEINS; GENE DELETION; GENES, FUNGAL; GLYCEROL; MODELS, GENETIC; MOLECULAR SEQUENCE DATA; MUTATION; NUCLEAR PROTEINS; PHENOTYPE; REPRESSOR PROTEINS; SACCHAROMYCES CEREVISIAE PROTEINS; SEQUENCE ALIGNMENT; TEMPERATURE; TRANSCRIPTION FACTORS; TRANSCRIPTION, GENETIC;

EID: 0030824249     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.277.5322.105     Document Type: Article

References (35)

1. R. H. Rubin, Eur. J. Clin. Microbiol. Infect. Dis. 12 Suppl. 1, S42 (1993); M. N. Dudley and R. T. Schiefe, Eds., Pharmacotherapy 10, 133 (1990).
2. R. H. Rubin, Eur. J. Clin. Microbiol. Infect. Dis. 12 Suppl. 1, S42 (1993); M. N. Dudley and R. T. Schiefe, Eds., Pharmacotherapy 10, 133 (1990).
3. F. C. Odds, Candida and Candidosis (Baillière Tindall, London, ed. 2, 1988).
4. _, Am. Soc. Microbiol. News 60, 313 (1994); J. Am. Acad. Dermatol. 31, S2 (1994).
5. _, Am. Soc. Microbiol. News 60, 313 (1994); J. Am. Acad. Dermatol. 31, S2 (1994).
6. _, Crit. Rev. Microbiol. 12, 45 (1985); N. A. Gow and G. W. Gooday, Sabouraudia 22, 137 (1984).
7. _, Crit. Rev. Microbiol. 12, 45 (1985); N. A. Gow and G. W. Gooday, Sabouraudia 22, 137 (1984).
8. H. Liu, J. Kohler, G. R. Fink, Science 266, 1723 (1994).
9. S. J. Kron and N. A. Gow, Curr. Opin. Cell. Biol. 7, 845 (1995); J. R. Köhler and G. R. Fink, Proc. Natl. Acad. Sci. U.S.A. 93, 13223 (1996); E. Leberer et al., ibid., p. 132217.
10. S. J. Kron and N. A. Gow, Curr. Opin. Cell. Biol. 7, 845 (1995); J. R. Köhler and G. R. Fink, Proc. Natl. Acad. Sci. U.S.A. 93, 13223 (1996); E. Leberer et al., ibid., p. 132217.
11. S. J. Kron and N. A. Gow, Curr. Opin. Cell. Biol. 7, 845 (1995); J. R. Köhler and G. R. Fink, Proc. Natl. Acad. Sci. U.S.A. 93, 13223 (1996); E. Leberer et al., ibid., p. 132217.
12. F. E. Williams and R. J. Trumbly, Mol. Cell. Biol. 10, 6500 (1990).
13. C. A. Keleher, M. J. Redd, J. Schultz, M. Carlson, A. D. Johnson, Cell 68, 709 (1992).
14. J. F. Lemontt, D. R. Fugit, V. L. Mackay, Genetics 94, 899 (1980).
15. D. Tzamarias and K. Struhl, Nature 369, 758 (1994); K. Komachi, M. J. Redd, A. D. Johnson, Genes Dev. 8, 2857 (1994); M. Wahi and A. D. Johnson, Genetics 140, 79 (1995); D. G. Edmondson, M. M. Smith, S. Y. Roth, Genes Dev. 10, 1247 (1996).
16. D. Tzamarias and K. Struhl, Nature 369, 758 (1994); K. Komachi, M. J. Redd, A. D. Johnson, Genes Dev. 8, 2857 (1994); M. Wahi and A. D. Johnson, Genetics 140, 79 (1995); D. G. Edmondson, M. M. Smith, S. Y. Roth, Genes Dev. 10, 1247 (1996).
17. D. Tzamarias and K. Struhl, Nature 369, 758 (1994); K. Komachi, M. J. Redd, A. D. Johnson, Genes Dev. 8, 2857 (1994); M. Wahi and A. D. Johnson, Genetics 140, 79 (1995); D. G. Edmondson, M. M. Smith, S. Y. Roth, Genes Dev. 10, 1247 (1996).
18. D. Tzamarias and K. Struhl, Nature 369, 758 (1994); K. Komachi, M. J. Redd, A. D. Johnson, Genes Dev. 8, 2857 (1994); M. Wahi and A. D. Johnson, Genetics 140, 79 (1995); D. G. Edmondson, M. M. Smith, S. Y. Roth, Genes Dev. 10, 1247 (1996).
19. 2-terminal GHEQDIYS. Cycling parameters were 1 min at 95°C, 1 min at 55°C, 1 min ramp to 73°C, and 3 min at 73°C (Perkin-Elmer Cetus 480 cycler). The resulting 659-bp PCR fragment was cloned via the Pst I and Kpn I sites on the ends into Bluescript-derived pVZ1 to produce p348. A λ library of C. albicans genomic DNA was provided by N. Agabian and colleagues (UCSF), and was screened with labeled insert from p348. A 7-kbp TUP1-containing Kpn I-Xba I fragment from λ363 was cloned into pVZ1 to form p371. Both strands of the TUP1 open reading frame were sequenced. The C. albicans TUP1 DNA and protein sequences have been deposited in GenBank (AF005741).
20. M. A. Wall et al., Cell 83, 1047 (1995).
21. The C. albicans TUP1 open reading frame was amplified with Pfu polymerase (Stratigene) and the primers: 5′CGCGGATCCCCACCAGCAATGTCCATGTAT; 5′GCGGGTACCGCGATGTTGACGGGTGCTGT. The product was cloned into the CEN/ARS/URA3/Gal1-10 expression vector pRD53 (provided by R. Deshaies, California Institute of Technology) to form the S. cerevisiae expression plasmid pMH1. C. albicans TUP1 contains no CUG codons, which encode serine in C, albicans, but encode leucine in S. cerevisiae and elsewhere [T. Ohama, et al., Nucleic Acids Res. 21, 4039 (1993)]. The same PCR product was cloned into pDBV52 (provided by C. Kumamoto and D. Brown, Tufts) to form the maltose-regulated expression plasmid p455, which was transformed into BCa2-9. pAJ181 has been described (8). To assess TUP1 function, β-galactosidase activity was assayed from tup1 S. cerevisiae (KKY110) carrying the plasmids described above. KKY110 (Matα, tup1, mfa2::lacZ, leu2, ura3, trp1, his4; provided by K. Komachi, UCSF) had a β-galactosidase reporter gene under α2/MCM1/TUP1 control integrated at the MFA2 gene. On glucose, the vector (pRD53) conferred 82 ± 16 units, (no repression); pAJ181 (S. cerevisiae TUP1) conferred 3.8 ± 0.9 units; and pMH1 (Gal-driven C. albicans TUP1) conferred 32 ± 5 units. On galactose, the vector conferred 83 + 27 units (no repression); pAJ181, 0.7 ± 0.5 units; and pMH1, 0.5 ± 0.4 units (full repression).
22. W. A. Fonzi and M. Y. Irwin, Genetics 134, 717 (1993). The C. albicans URA3 gene, flanked by tandemly repeated DNA sequences, was inserted in place of TUP1 within the genomic clone (Fig. 2A) to form p383C, which was treated with Sph I to remove the vector and transformed into a ura3 C. albicans cell (CAI4). The URA3 transformants were screened by DNA blotting for disruption of one TUP1 gene by homologous recombination. After being selected on 5-FOA for ura3 "pop-out" revertants, a second cycle of transformation was performed. DNA blotting revealed the successive disruption of both copies of the TUP1 gene (Fig. 2B, compare lanes 2, 3, and 6). Transformations of S. cerevisiae were done by a modified lithium acetate technique [ R. D. Gietz, R. H. Schiestl, A. R. Wiltems, R. A. Woods, Yeast 11, 355 (1995); J. Hill, K. A. Donald, D. E. Griffiths, G. Donald, Nucleic Acids Res. 19, 5791 (1991)]. Transformation of C. albicans was identical, except that DMSO was omitted, incubation times at 30°C and 42°C were extended to 3 hours and 1 hour, respectively, and uridine at 25 μg/ml was added to the plating solution. All C. albicans strains shared the SC5314 background. The C. albicans allele tup1:hisG described is referred to as tup1 Δ-1.
23. W. A. Fonzi and M. Y. Irwin, Genetics 134, 717 (1993). The C. albicans URA3 gene, flanked by tandemly repeated DNA sequences, was inserted in place of TUP1 within the genomic clone (Fig. 2A) to form p383C, which was treated with Sph I to remove the vector and transformed into a ura3 C. albicans cell (CAI4). The URA3 transformants were screened by DNA blotting for disruption of one TUP1 gene by homologous recombination. After being selected on 5-FOA for ura3 "pop-out" revertants, a second cycle of transformation was performed. DNA blotting revealed the successive disruption of both copies of the TUP1 gene (Fig. 2B, compare lanes 2, 3, and 6). Transformations of S. cerevisiae were done by a modified lithium acetate technique [ R. D. Gietz, R. H. Schiestl, A. R. Wiltems, R. A. Woods, Yeast 11, 355 (1995); J. Hill, K. A. Donald, D. E. Griffiths, G. Donald, Nucleic Acids Res. 19, 5791 (1991)]. Transformation of C. albicans was identical, except that DMSO was omitted, incubation times at 30°C and 42°C were extended to 3 hours and 1 hour, respectively, and uridine at 25 μg/ml was added to the plating solution. All C. albicans strains shared the SC5314 background. The C. albicans allele tup1:hisG described is referred to as tup1 Δ-1.
24. W. A. Fonzi and M. Y. Irwin, Genetics 134, 717 (1993). The C. albicans URA3 gene, flanked by tandemly repeated DNA sequences, was inserted in place of TUP1 within the genomic clone (Fig. 2A) to form p383C, which was treated with Sph I to remove the vector and transformed into a ura3 C. albicans cell (CAI4). The URA3 transformants were screened by DNA blotting for disruption of one TUP1 gene by homologous recombination. After being selected on 5-FOA for ura3 "pop-out" revertants, a second cycle of transformation was performed. DNA blotting revealed the successive disruption of both copies of the TUP1 gene (Fig. 2B, compare lanes 2, 3, and 6). Transformations of S. cerevisiae were done by a modified lithium acetate technique [ R. D. Gietz, R. H. Schiestl, A. R. Wiltems, R. A. Woods, Yeast 11, 355 (1995); J. Hill, K. A. Donald, D. E. Griffiths, G. Donald, Nucleic Acids Res. 19, 5791 (1991)]. Transformation of C. albicans was identical, except that DMSO was omitted, incubation times at 30°C and 42°C were extended to 3 hours and 1 hour, respectively, and uridine at 25 μg/ml was added to the plating solution. All C. albicans strains shared the SC5314 background. The C. albicans allele tup1:hisG described is referred to as tup1 Δ-1.
25. Cells were fixed for microscopy with 70% ethanol, rinsed twice in water, and incubated in 4′,6-diamidino-2-phenylindole hydrochloride (DAPI) (250 ng/ ml) or calcofluor white M2R (a boshork) (500 μg/ml) for 10 min at room temperature. DAPI-stained cells were rinsed once before mounting in 50% glycerol, and calcofluor-stained cells were rinsed four times. Fluorescence and differential interference contrast micrographs were taken on a Nikon Optiphot microscope with 40× and 100× objectives with DAPI-specific illumination and filters. Micrographs of cells on plates were taken on an Olympus B×40 microscope, with 10× and 40× objectives with phase. We used the Dalmau plate technique to investigate filamentous growth from colonies of C. albicans [M. R. McGinnis, Laboratory Handbook of Medical Mycology (Academic Press, New York, 1980)].
26. Standard yeast media such as yeast extract with peptone and dextrose (YEPD) were made as described [F. Sherman, in Guide to Yeast Genetics and Molecular Biology, C. Guthrie and G. R. Fink, Eds. (Academic Press, San Diego, 1991), vol. 194, p. 3] Uridine (25 μg/ml) was added to 5-fluoroorotic acid plates used to counter-select against URA3 in C. albicans. SLAHD (19), Spider (5), and Lee's (17) media were made as described. Saboraud dextrose agar and commeal agar (Difco) plates were made to manufacturer's directions, with added 0.33% Tween 80 (16).
27. K. L. Lee, H. R. Buckley, C. C. Campbell, Sabouraudia 13, 148 (1975).
28. L. A. Merson-Davies and F. C. Odds, J. Gen. Microbiol. 135, 3143 (1989).
29. C. J. Gimeno, P. O. Ljungdahl, C. A. Styles, G. R. Fink, Cell 68, 1077 (1992).
30. R. L. Roberts and G. R. Fink, Genes Dev. 8, 2974 (1994); R. M. Wright, T. Repine, J. E. Repine, Curr. Genet 23, 388 (1993).
31. R. L. Roberts and G. R. Fink, Genes Dev. 8, 2974 (1994); R. M. Wright, T. Repine, J. E. Repine, Curr. Genet 23, 388 (1993).
32. Obtained from G. Fink and colleagues.
33. S. cerevisiae disruptions were carried out with marked fragments from the plasmids pFW40 [URA3 (7)] and pCK36 [LEU2 (8)]. All S. cerevisiae strains but KKY110 shared the Σ1278b pseudohyphal-competent background (19). KKY110 (K. Komachi; UCSF) derives from EG123. Pseudohyphal-competent strains L5684 and L5487 (provided by G. Fink and colleagues; Whitehead Institute) were mated by micromanipulation to create diploid BB8, which was sequentially transformed to disrupt both copies of TUP1. Alterations at the locus were assayed by whole-cell PCR with appropriate oligonucleotides.
34. Preliminary results indicate that mutant tup1 C. albicans (BCa2-10;tup1/tup1, URA3/ura3) are far less infectious in mice than are the parental wild-type (SC5314) cells. This lack of infectivity could be due to constitutive filamentous growth, lack of germ tube formation, or other defects of the mutant strain (P. L. Fidel, Jr., B. R. Braun, and A. D. Johnson, unpublished data).
35. We thank N. Agabian, W. Fonzi, T. Brake, G. Fink, C. Kumamoto, D. Brown, and members of the Johnson laboratory for materials; J. Edman and P. O'Farrell for microscope facilities; T. White, M. McEachern, T. Shermoen, and members of the Johnson laboratory for assistance and discussions; and M. Hooper for help in construction of the S. cerevisiae expression clone. Supported by an American Cancer Society postdoctoral fellowship (B.R.B.), and by NIH grant GM37049 (A.D.J.).