Enhancement of Class II-restricted T cell responses by costimulatory NK receptors for Class I MHC proteins

Science

Volumn 274, Issue 5295, 1996, Pages 2097-2100

  Mandelboim, Ofer ^a   Davis, Daniel M ^a   Reyburn, Hugh T ^a   Valés Gómez, Mar ^a   Sheu, Eric G ^a   Pazmany, Laszlo ^a   Strominger, Jack L ^a  

^a HARVARD UNIVERSITY   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

MAJOR HISTOCOMPATIBILITY ANTIGEN CLASS 2;

ALLELE; ANTIBODY RESPONSE; ANTIGEN PRESENTATION; ARTICLE; CELL STIMULATION; GENETIC TRANSFECTION; HUMAN; HUMAN CELL; IMMUNE RESPONSE; IMMUNOSTIMULATION; KILLER CELL; PRIORITY JOURNAL; T LYMPHOCYTE; TARGET CELL;

B-LYMPHOCYTES; CELL LINE; CLONE CELLS; HISTOCOMPATIBILITY ANTIGENS CLASS I; HISTOCOMPATIBILITY ANTIGENS CLASS II; HLA ANTIGENS; HLA-C ANTIGENS; HUMANS; LYMPHOCYTE ACTIVATION; RECEPTORS, IMMUNOLOGIC; SUPERANTIGENS; T-LYMPHOCYTES; TRANSFECTION;

EID: 0030448265     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.274.5295.2097     Document Type: Article

References (39)

1. V. A. Boussiotis, J. G. Gribben, G. J. Freeman, L, M. Nadler, Curr. Opin. Immunol. 6, 797 (1994).
2. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
3. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
4. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
5. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
6. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
7. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
8. E, Ciccone et al., Proc. Natl. Acad. Sci. U.S.A. 87, 9794 (1990); E. Ciccone et al., J. Exp. Med. 175, 709 (1992); V. Litwin et al., ibid. 178, 1321 (1993); M. Colonna and J. Samaridis, Science 268, 405 (1995); A. D'Andrea et al., J. Immunol. 155, 2306 (1995); J. E. Gumperz and P. Parham, Nature 378, 245 (1995); A. Moretta et al., Annu. Rev. Immunol. 14, 619 (1996).
9. N. Wagtmann et al., Immunity 2, 439 (1995).
10. M. Colonna, E. G. Brooks, M. Falco, G. B. Ferrara, J. L Strominger, Science 260, 1121 (1993); M. Colonna, G. Borsellino, M. Falco, G. B. Ferrara, J. L. Strominger, Proc. Natl. Acad. Sci. U.S.A., 90, 12000 (1993).
11. M. Colonna, E. G. Brooks, M. Falco, G. B. Ferrara, J. L Strominger, Science 260, 1121 (1993); M. Colonna, G. Borsellino, M. Falco, G. B. Ferrara, J. L. Strominger, Proc. Natl. Acad. Sci. U.S.A., 90, 12000 (1993).
12. O. Mandelboim et al., J. Exp. Med. 184, 913 (1996).
13. M. Cella et al., ibid. 180, 1235 (1994); J. E. Gumperz et al., ibid. 181, 1133 (1995).
14. M. Cella et al., ibid. 180, 1235 (1994); J. E. Gumperz et al., ibid. 181, 1133 (1995).
15. L. Olcese et al., J. Immunol. 156, 4531 (1996); D. N. Burshtyn et al., Immunity 4, 77 (1996); A. M. Fry et al., J. Exp. Med. 184, 295 (1996); K. S. Campbell et al., ibid., p. 93.
16. L. Olcese et al., J. Immunol. 156, 4531 (1996); D. N. Burshtyn et al., Immunity 4, 77 (1996); A. M. Fry et al., J. Exp. Med. 184, 295 (1996); K. S. Campbell et al., ibid., p. 93.
17. L. Olcese et al., J. Immunol. 156, 4531 (1996); D. N. Burshtyn et al., Immunity 4, 77 (1996); A. M. Fry et al., J. Exp. Med. 184, 295 (1996); K. S. Campbell et al., ibid., p. 93.
18. L. Olcese et al., J. Immunol. 156, 4531 (1996); D. N. Burshtyn et al., Immunity 4, 77 (1996); A. M. Fry et al., J. Exp. Med. 184, 295 (1996); K. S. Campbell et al., ibid., p. 93.
19. H. Spits, L. L. Lanier, J. H. Phillips, Blood 85, 10 (1995).
20. M. C. Mingari et al., Int. Immunol. 7, 697 (1995); C. S. Falk, A. Steinle, D. J. Schendel, J. Exp. Med. 182, 1005 (1995); S. Ferrini et al., Eur. J. Immunol. 24, 2294 (1994); H. Nakajima, H. Tomiyama, M. Takiguchi, J. Immunol. 155, 4139 (1995).
21. M. C. Mingari et al., Int. Immunol. 7, 697 (1995); C. S. Falk, A. Steinle, D. J. Schendel, J. Exp. Med. 182, 1005 (1995); S. Ferrini et al., Eur. J. Immunol. 24, 2294 (1994); H. Nakajima, H. Tomiyama, M. Takiguchi, J. Immunol. 155, 4139 (1995).
22. M. C. Mingari et al., Int. Immunol. 7, 697 (1995); C. S. Falk, A. Steinle, D. J. Schendel, J. Exp. Med. 182, 1005 (1995); S. Ferrini et al., Eur. J. Immunol. 24, 2294 (1994); H. Nakajima, H. Tomiyama, M. Takiguchi, J. Immunol. 155, 4139 (1995).
23. M. C. Mingari et al., Int. Immunol. 7, 697 (1995); C. S. Falk, A. Steinle, D. J. Schendel, J. Exp. Med. 182, 1005 (1995); S. Ferrini et al., Eur. J. Immunol. 24, 2294 (1994); H. Nakajima, H. Tomiyama, M. Takiguchi, J. Immunol. 155, 4139 (1995).
24. J. H. Phillips, J. E. Gumperz, P. Parham, L. L. Lanier, Science 268, 403 (1995).
25. A. Moretta et al., J. Exp. Med. 182, 875 (1995); R. Biassoni et al., ibid. 184, 645 (1996).
26. A. Moretta et al., J. Exp. Med. 182, 875 (1995); R. Biassoni et al., ibid. 184, 645 (1996).
27. + T cells were not depleted.
28. Cells were typed by flow cytometry for the presence of CD3, CD4, CD8, CD16, CD56, TCRαβ, and TCRγδ (with antibodies from Becton-Dickinson), the type of TCR (with antibodies from Coulter Immunology), CD94 (with mAb HP3B1), and NK receptors [with mAbs specific for NK1 receptor (HP3E4), NK2 receptor (GL183, Coulter Immunology), and NK3 receptor (DX9)].
29. Oligonucleotides complementary to nonpolymorphic regions of the known NK receptor sequences were chosen as GATGGTACATGTCATAGGAGCTCC (at the 3′ end) and GAAAACCTTCCCTCCTGGCCC (at the 5′ end). The resultant PCR product that was amplified from cDNA derived from the T cell was cloned into pCRII (Invitrogen). The sequence of the insert was determined by automated sequencing at the Molecular Biology Core Facilities at the Dana-Farber Cancer Institute, Boston, MA. This sequence was then aligned against sequences currently held in the Gen-Bank database with the program BLAST. The insert obtained from the cDNA of clone TANK-1 was 100% identical to that of the NK receptor, clone 39.
30. Reverse transcriptase-PCR typing of NK receptors was performed with oligonucleotides complementary to polymorphic regions of the extracellular portions of the known NK receptors and with oligonucleotides complementary to the long and short cytoplasmic tail sequences of NK receptors (H. T. Reyburn et al., in preparation).
31. + TANK cells have also been obtained (O. Mandelboim et al., in preparation).
32. Y. Shimizu and R. DeMars, J. Immunol. 142, 3320 (1989).
33. 3H]thymidine was added to each well, and the cells were further incubated at 37°C overnight. The cells were then harvested (Harvester 96 Mach III M, Tomtec) and counted on a liquid scintillation counter (1450 Microbeta Plus, Wallac). In analysis of the counts per minute (cpm) from each well, the background cpm from a well in which identical reagents and target cells were placed in the absence of any T cells was subtracted.
34. O. Mandelboim, D. M. Davis, H. T. Reyburn, E. G. Sheu, unpublished data.
35. J. F. A. P. Miller and G. Morahan, Annu. Rev. Immunol. 10, 51 (1992).
36. L. Pazmany et al., Science 274, 792 (1996).
37. This may be because HLA-G has a greater binding affinity for NK2 than for NK1 receptors or because HLA-G can interact with other inhibitory receptors on lymphocytes yet to be determined. Alternatively, the signals for inhibition of the proliferate response could be dominant over activating signals when both are triggered in this clone.
38. A. D'Andrea, J. Exp. Med. 194, 784 (1996).
39. We thank M. Lopéz-Botet (mAbs HP3B1 and HP3E4) and L. Lanier (mAb DX9). Supported by EMBO and the Fullbright Commission (O.M.), The Wellcome Trust (H.T.R.), the Arthritis Foundation (L.P.), and NIH grant CA 47554.