메뉴 건너뛰기




Volumn 278, Issue 5341, 1997, Pages 1309-1312

A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia

Author keywords

[No Author keywords available]

Indexed keywords

HYBRID PROTEIN; PROTEIN TYROSINE KINASE;

EID: 15444339209     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.278.5341.1309     Document Type: Article
Times cited : (695)

References (30)
  • 5
    • 0029045087 scopus 로고
    • S. P. Romana et al., Blood 85, 3662 (1995).
    • (1995) Blood , vol.85 , pp. 3662
    • Romana, S.P.1
  • 8
    • 15444355680 scopus 로고    scopus 로고
    • V. Lacronique et al., data not shown
    • V. Lacronique et al., data not shown.
  • 10
    • 15444352465 scopus 로고    scopus 로고
    • note
    • PCR experiments were performed starting from 100 ng of randomly primed reverse-transcribed RNA for 35 cycles. The primers used for PCR were B8, B12 (25), P3 (tggaattcTGCAGTGGAGGAGATAAA), and P6 (CCTTGCCAAGTTGCTGTAGA) for JAK2. The specificity of the amplifications was verified by nucleotide sequence analysis.
  • 12
    • 0028059109 scopus 로고
    • O. Miura et al., Blood 84, 1501 (1994).
    • (1994) Blood , vol.84 , pp. 1501
    • Miura, O.1
  • 14
  • 16
    • 17144463437 scopus 로고    scopus 로고
    • C. Jousset et al., EMBO J. 16, 69 (1997).
    • (1997) EMBO J. , vol.16 , pp. 69
    • Jousset, C.1
  • 18
    • 0030852328 scopus 로고    scopus 로고
    • P. Peeters et al., Blood 90, 2535 (1997).
    • (1997) Blood , vol.90 , pp. 2535
    • Peeters, P.1
  • 20
    • 15444348337 scopus 로고    scopus 로고
    • note
    • 4 cells per well). The number of wells showing proliferating cells in either the absence or presence of IL-3 was scored after 1 week in culture.
  • 21
    • 13344295097 scopus 로고    scopus 로고
    • N. Meydan et al., Nature 379, 645 (1996).
    • (1996) Nature , vol.379 , pp. 645
    • Meydan, N.1
  • 25
    • 0028805405 scopus 로고
    • S. P. Romana et al., Blood 86, 4263 (1995).
    • (1995) Blood , vol.86 , pp. 4263
    • Romana, S.P.1
  • 26
    • 15444349831 scopus 로고    scopus 로고
    • note
    • The cDNA from patient 2 (an atypical chronic myelogenous leukemia case in transformation) was amplified with the TEL primer ATGCACCCTCTGATCCTGAACC and the JAK2 primer TGGTGAGGTTGGTACATCAG. The cDNA from patient 3 (a precursor B cell ALL case) was amplified with the TEL primer TTCCACCCTGGAAACTCTATA and the JAK2 primer AAGGTTTGCTAATTCTGCCCACTTTGGTGC. PCR products were sequenced on an ALF sequencer.
  • 27
    • 8044224661 scopus 로고    scopus 로고
    • H. Poirel et al., Oncogene 14, 349 (1997).
    • (1997) Oncogene , vol.14 , pp. 349
    • Poirel, H.1
  • 29
    • 0029010473 scopus 로고
    • C. Pallard et al., EMBO J. 14, 2847 (1995).
    • (1995) EMBO J. , vol.14 , pp. 2847
    • Pallard, C.1
  • 30
    • 15444357566 scopus 로고    scopus 로고
    • note
    • We thank M. Le Coniat for FISH experiments, H. Beug for the murine Jak2 cDNA, P. Mayeux for helpful hints, P. Peeters and P. Marynen for sharing unpublished data, and S. Gisselborecht and G. Calothy for critical reading of the manuscript. Supported by the Association pour la Recherche sur le Cancer (V.L. and A.B.), the Ligue Nationale Contre le Cancer (C.T.Q.), and funds from INSERM, CNRS, Institut Curie, Association pour la Recherche sur le Cancer, Ligue Nationale Contre le Cancer, Ligue Départementale Contre le Cancer (Comité de Paris), and the Biomed Programme of the European Community (contract BMH4-CT96-1355).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.