RNA-catalyzed RNA polymerization: Accurate and general RNA-templated primer extension

Science

Volumn 292, Issue 5520, 2001, Pages 1319-1325

  Johnston, Wendy K ^a   Unrau, Peter J ^a,b   Lawrence, Michael S ^a   Glasner, Margaret E ^a   Bartel, David P ^a  

^a WHITEHEAD INSTITUTE FOR BIOMEDICAL RESEARCH   (United States)

^b SIMON FRASER UNIVERSITY   (Canada)

Author keywords

[No Author keywords available]

Indexed keywords

CATALYSIS; CLONING; POLYMERIZATION;

EARLY EVOLUTION;

RNA;

NUCLEOSIDE TRIPHOSPHATE; NUCLEOTIDE; PRIMER RNA; RIBOZYME; RNA;

ARTICLE; CATALYSIS; MOLECULAR CLONING; MOLECULAR EVOLUTION; NONHUMAN; NUCLEOTIDE SEQUENCE; POLYMERIZATION; PRIORITY JOURNAL; RNA REPLICATION; RNA SEQUENCE;

BASE SEQUENCE; BIOGENESIS; CONSERVED SEQUENCE; DIRECTED MOLECULAR EVOLUTION; MOLECULAR SEQUENCE DATA; MUTAGENESIS; NUCLEIC ACID CONFORMATION; RNA; RNA REPLICASE; RNA, CATALYTIC; SEQUENCE ANALYSIS, RNA; SUBSTRATE SPECIFICITY; TEMPLATES, GENETIC;

EID: 0035906978     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.1060786     Document Type: Article

References (49)

1. G. F. Joyce, L. E. Orgel, in The RNA World, R. F. Gesteland, T. R. Cech, J. F. Atkins, Eds. (Cold Spring Harbor Laboratory Press, New York, 1999), pp. 49-77.
2. N. R. Pace, T. L. Marsh, Origins Life 16, 97 (1985).
3. P. A. Sharp, Cell 42, 397 (1985).
4. T. R. Cech, Proc. Natl. Acad. Sci. USA 83, 4360 (1986).
5. L. E. Orgel, J. Theor. Biol. 123, 127 (1986).
6. A. J. Hager, J. D. Pollard, J. W. Szostak, Cnem. Biol. 3, 717 (1996).
7. D. P. Bartel, in The RNA World R. F. Gesteland, T. R. Cech, J. F. Atkins, Eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1999), pp. 143-162.
8. D. P. Bartel, P. J. Unrau, Trends Cell Biol. 9, M9 (1999).
9. J. W. Szostak, D. P. Bartel, P. L. Luisi, Nature 409, 387 (2001).
10. J. A. Doudna, J. W. Szostak, Nature 339, 519 (1989).
11. J. A. Doudna, S. Couture, J. W. Szostak, Science 251, 1605 (1991).
12. R. Green, J. W. Szostak, Science 258, 1910 (1992).
13. D. P. Bartel, J. W. Szostak, Science 261, 1411 (1993).
14. E. H. Ekland, J. W. Szostak, D. P. Bartel, Science 269, 364 (1995).
15. E. H. Ekland, D. P. Bartel, Nature 382, 373 (1996).
16. _, Nucleic Acids Res. 23, 3231 (1995).
17. 15.
18. 2, 200 mM KCl, 50 mM EPPS, pH 8.0, 22°lC). In rounds 10 to 18, incubations also included 1.0 μM reverse-transcription primer (TTCAGATTGTAGCCTTC) and lacked KCl. The pool RNA and oligonucleotides were mixed together in water, incubated at 80°C for 3 min, then allowed to cool to room temperature for 10 min. Pool extension reactions were started by the simultaneous addition of pool extension buffer and NTPs. Reactions were stopped with addition of 80 mM EDTA after 0.1 to 36 hours (Table 1). Excess 4-thioUTP was removed with a Centricon YM-10 centrifugal filter device (Millipore), and molecules that had been tagged with 4-thioU were isolated on APM gels (44). APM gels were prepared by using 10 to 80 μM APM in the lower portion of the gel, no APM in the top portion of the gel, and 8M urea per 5% acrylamide throughout the gel (Fig. 2). For isolation of RNA extended with at least one 4-thioU (rounds 1 to 10, Table 1), RNA was eluted from a gel slice extending from the APM interface to the migration of pool RNA with a single 4-thioU. For isolation of RNA extended by at least two 4-thioUs (Table 1), RNA was eluted from a slice containing only the APM interface. In rounds 2 to 5, 9, 12 to 14, and 17, RNA was further purified on a second APM gel. Eluted RNA was precipitated and reverse-transcribed (16) by using primer CGGGACTCTGACCTTGG (rounds 1 to 3, 6) AAACGGGACTCTGACCTTG (rounds 4, 5, 7, 9), TTCGGGACTCTGACCTT (rounds 8, 10), or TTCAGATTGTAGCCTTC (rounds 11 to 18). RT primers were alternated in rounds 4 to 10 to vary the 3′-terminal residues of the pool RNA, disfavoring the selection of molecules that extend their 3′ terminus rather than extending the attached primer. In rounds including biotinylated ATP (biotin-N6-ATP, New England Nuclear), RNA-cDNA duplex molecules were also purified by capture on streptavidin magnetic beads (16). PCR amplification of the cDNA used a primer that completed the T7 RNA polymerase promoter sequence, (TTCTAATACGACTCACTATAGGACAACC, italics, T7 promoter sequence; underline, 5′ primer-binding site, Fig. 1B). PCR DNA was transcribed (16) to generate RNA for the next round of selection or cloned (Topo cloning kit, Invitrogen) for sequencing and further analysis.
19. Throughout this manuscript, added nucleotide residues (pA, pC, pG, and pU) are abbreviated by the corresponding nucleoside symbols (A, C, G, and U).
20. W. K. Johnston, D. P. Bartel, data not shown.
21. To examine whether the ribozyme preferred substrate sequences used during its selection, the primer-template from selection rounds 1, 6, 8, and 9 (Table 1) was also tested and found not to be used any more efficiently than the substrate of Fig. 3.
22. 15.
23. Supplemental material describing comparative sequence analysis of ribozyme variants, engineering of shorter and more active polymerase constructs, nuclease analysis of the primer-extension product, methods for Fig. 4C, and RNAs of Fig. 5 is available on Science online at www.sciencemag.org/cgi/content/ full/292/5520/1319/DC1
24. -1, and relative efficiencies were 0.0007, 1.0, 0.002, and 0.017 with ATP, CTP, GTP, and UTP, respectively, for a fidelity at G6 of 0.981 -somewhat better than the 0.957 fidelity seen across from a G at coding residue four (Table 2). Thus, sequence context can influence accuracy of polymerization, a phenomenon also observed with protein polymerases (26, 27).
25. For example, in one context, relative extension efficiencies were 1.0, 0.044, 0.78, or 0.056 when the previous nucleotide was a U incorporated across from an A, C, G, or U template residue, respectively.
26. H. Echols, M. F. Goodman, Annu. Rev. Biochem. 60, 477 (1991).
27. T. A. Kunkel, Bioessays 14, 303 (1992).
28. D. A. Steinhauer, J. J. Holland, J. Virol. 57, 219 (1986).
29. C. D. Ward, J. B. Flanegan, J. Virol. 66, 3784 (1992).
30. L. A. Loeb, T. A. Kunkel, Annu. Rev. Biochem. 51, 429 (1982).
31. M. T. Washington, R. E. Johnson, S. Prakash, L. Prakash, J. Biol. Chem. 274, 36835 (1999).
32. m values from (31), the optimal ratio of dNTP concentrations for yeast pol η would be 100:23:90:35 for dATP, dCTP, dGTP, and TTP, respectively. When using the values from Table 2 for the round-18 ribozyme, a ratio of 50:100:4:25 for ATP, CTP, GTP, and UTP would result in an observed fidelity of 0.990.
33. 2, 200 mM KCl, 50 mM EPPS, pH 8.0, 22°C), the standard assay conditions were more optimal. Ribozyme, primer, template, and NTPs were included at the concentrations indicated, and the GGCACCA RNA that completes the ligase domain was in 1.25-fold molar excess over the ribozyme concentration. These RNAs were mixed together in water, incubated at 80°C for 3 min, then incubated at 22°C for at least 5 min before starting the reaction by simultaneous addition of buffer, salt, and NTPs. Heating the ribozyme separately from the primer and template RNAs did not affect the polymerization reaction kinetics. Reactions were stopped by addition of 1.6 volumes of 145 mM EDTA/6 M urea, heated (90°C, 5 min) in the presence of competitor RNA designed to hybridize to the template RNA, then analyzed on sequencing gels. Incubation with competitor RNA, added in 10-fold molar excess over template RNA, led to better gel resolution because it prevented reassociation of the extended primer with the template.
34. N. H. Bergman, W. K. Johnston, D. P. Bartel, Biochemisty 39, 3115 (2000).
35. M. E. Glasner, C. C. Yen, E. H. Ekland, D. P. Bartel, Biochemistry 39, 15556 (2000).
36. P. J. Unrau, D. P. Bartel, unpublished results.
37. 160 = 0.45 ≈ 2/5). Note that this scenario does not account for the dilution of productive ribozyme that would occur as active ribozyme variants replicate an increasing number of inactive variants; compartmentalization and selection would be needed to achieve sustainable replication (7, 9).
38. (6-8)′, RNA primer segment 6 to 8 nt in length complementary to the template indicated in Table 1). The pool was then gel-purified to remove the splint oligonucleotide needed for ligation.
39. An A analog, 2-aminopurine pairs with U and 4-thioU. but unlike A, its Watson-Crick pairing with 4-thioU does not involve the sulfur atom. Because the sulfur atom subtly distorts pairing geometry, templates with 2-aminopurine were used in later rounds of selection.
40. Repeated error-prone PCR was performed as described (13), except serial dilutions were after every 6 cycles of PCR. RNA from four subpools with expected mutagenesis levels of 0, 2, 4, and 6%, was mixed and used for round 15. RNA from two subpools with expected mutagenesis levels of 0 and 1% was used for round 16. RNA from two subpools with expected mutagenesis levels of 0 and 2% was used for round 17.
41. Because the net accuracy of RNA polymerization is represented by the product of the fidelities for each added nucleotide, geometric averages are reported throughout this study when describing overall fidelity.
42. J. N. Bausch, F. R. Kramer, E. A. Miele, C. Dobkin, D. R. Mills, J. Biol. Chem. 258, 1978 (1983).
43. J. M. Clark, Nucleic Acids Res. 16, 9677 (1988).
44. P. J. Unrau, D. P. Bartel, Nature 395, 260 (1998).
45. (1/11) = 0.969, a value very close to the generic overall fidelity of 0.967 calculated in Table 2.
46. C. Kao, M. Zheng, 5. Rudisser, RNA 5, 1268 (1999).
47. M. J. Moore, P. A. Sharp, Science 256, 992 (1992).
48. T. Tuschl, M. P. Ng, W. Pieken, F. Benseler, F. Eckstein, Biochemistry 32, 11658 (1993).
49. We thank members of the laboratory and F. Solomon for helpful comments on this manuscript. Supported by grants from the NIH (D.P.B.), a Medical Research Council (Canada) postdoctoral fellowship (P.J.U.), and a Howard Hughes Medical Institute predoctoral fellowship (M.E.G.).