메뉴 건너뛰기




Volumn 292, Issue 5520, 2001, Pages 1389-1394

Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets

Author keywords

[No Author keywords available]

Indexed keywords

DISEASES; GLUCOSE; INSULIN; MEDICAL IMAGING; NEUROLOGY; TOPOLOGY;

EID: 0035906902     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.1058866     Document Type: Article
Times cited : (1333)

References (48)
  • 1
    • 0032491416 scopus 로고    scopus 로고
    • J. A. Thomson et al., Science 282, 1145 (1998).
    • (1998) Science , vol.282 , pp. 1145
    • Thomson, J.A.1
  • 6
    • 0034597798 scopus 로고    scopus 로고
    • J. Yamashita et al., Nature 408, 92 (2000).
    • (2000) Nature , vol.408 , pp. 92
    • Yamashita, J.1
  • 13
  • 14
    • 0343472640 scopus 로고    scopus 로고
    • note
    • ES cells were cultured as described (11) with modifications as follows: B27 media supplement (75) (Gibco BRL, Gaithersburg, MA) was added during stages 4 and 5 at final concentration recommended by the manufacturer and nicotinamide (16) (Sigma, St. Louis, MO) was added during stage 5 at final concentration 10 mM.
  • 17
    • 0343036811 scopus 로고    scopus 로고
    • note
    • Total cellular RNA purification and RT-PCR was carried out as previously described (11). Identity of the PCR products was confirmed by sequencing. Forward and reverse primer sequences from 5′ to 3′ direction and the length of the amplified products were as follows: insulin I, TAGTGACCAGCTATAATCAGAG and ACGCCAAGGTCTGAAGGTCC (288 bp); insulin II, CCCTGCTGGCCCTGCTCTT and AGGTCTGAAGGT-CACCTGCT (212 bp); glucagon, TCATGACGTTTG-GCAAGTT and CAGAGGAGAACCCCAGATCA (202 bp); IAPP, GATTCCCTATTTGGATCCCC and CTCTCT-GTGGCACTGAACCA (221 bp); Glut2, CCACCCAGTT-TACAAGCTC and TGTAGGCAGTACGGGTCCTC (325 bp); PDX-1, TGTAGGCAGTACGGGTCCTC and CCAC-CCCAGTTTACAAGCTC (325 bp); α-amylase-2A, CATTGTTGCACCTTGTCACC and TTCTGCTGCTT-TCCCTCATT (300 bp); carboxypeptidase A, GCAAAT-GTGTGTTTGATGCC and ATGACCAAACTCTTGGAC-CG (521 bp); GATA-4, CGCCGCCTGTCCGCTTCC and TTGGGCTTCCGTTTTCTGGTTTGA (193 bp); HNF3β, ACCTGAGTCCGAGTCTGACC and GGCACCTTGAGAA-AGCAGTC (345 bp); OCT-4, GGCGTTCTCTTTG-GAAAGGTGTTC and CTCGAACCACATCCTTCTCT (293 bp); β-actin, ATGGATGACGATATCGCTG and ATGAG-GTAGTCTGTCAGGT (568 bp).
  • 20
    • 0032582513 scopus 로고    scopus 로고
    • J. Nichols et al., Cell 95, 379 (1998).
    • (1998) Cell , vol.95 , pp. 379
    • Nichols, J.1
  • 24
    • 0342602586 scopus 로고    scopus 로고
    • note
    • Cells were fixed in 4% paraformaldehyde/0.15% picric acid in phosphate-buffered saline (PBS). Immunocytochemistry was carried out with the use of standard protocols. The following primary antibodies were used at following dilutions: nestin rabbit polyclonal 1:500 (made in our laboratory), TUJ1 mouse monoclonal 1:500 and TUJ1 rabbit polyclonal 1:2000 (both from Babco, Richmond, CA), insulin mouse monodonal 1:1000 (Sigma, St. Louis, MO), insulin guinea pig polyclonal 1:100 (DAKO, Carpinteria, CA), glucagon rabbit polyclonal 1:75 (DAKO), somatostatin rabbit polyclonal 1:100 (DiaSorin, Stillwater, MN), GFP 1:750 polyclonal (Molecular Probes, Eugene, OR), and BRDU rat monoclonal 1:100 (Accurate, antibodies, Westbury, NY). For detection of primary antibodies, fluorescently labeled secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, and Molecular Probes) were used according to methods recommended by the manufacturers. Histochemical staining for alkaline phosphatase cells was carried out using commercially available kit (Sigma) following manufacturer's recommendations.
  • 28
    • 0343472637 scopus 로고    scopus 로고
    • note
    • 2+-free 3 mM EDTA containing Krebs-Ringer buffer after incubation for 15 min at 37°C The clusters were dissociated into single cells, as previously described (29). Dissociated cells were allowed to adhere to poly-ornithine/laminine-coated glass coverslips for 5 hours, fixed, immunostained for insulin, and counterstained with a nuclear stain DAPI (4′,6′diamidino-2-phenylindole). This was followed by determination of the percentage of insulin-positive cells in the total cell population.
  • 30
    • 0342602585 scopus 로고    scopus 로고
    • note
    • Stage 3 GFP-labeled B5 ES cells were co-cultured at clonal density on poly-ornithine/fibronectin treated-96-well plates [Costar 3603 (Fisher Scientific, Pittsburgh, PA) black plate with clear and thin bottom] with stage 3 wild-type E14.5 ES cells at a final concentration of 1 B5 cell per 40,000 E14.5 cells per well B5 cells were plated at a concentration of 1 85 cell per well using serial dilution. The seeding efficiency and the growth of the plated B5 cells were monitored by immunocytochemical staining for GFP. Two hours after seeding, GFP-positive cells were present in 65 ± 5% of the wells. Counterstaining with a nuclear dye (DAPI) confirmed presence of only one cell per well. After 6 days of differentiation, single GFP-labeled clones derived from a single B5 cell were present in 14.8 ± 1.7% of the wells. Cells were cultured through stages 4 and 5, as shown in Fig. 1A. On day 6 of stage 5, cells were fixed with 4% paraformaldehyde and subjected to triple immunocytochemistry and laser confocal microscopy analysis. For immunocytochemistry, after blocking with a solution of 90% PBS, 10% normal goat serum, and 0.3% Triton-X100, cells were stained with antibodies against insulin [mouse immunoglobulin G1 (IgG1)], GFP (mouse IgG2a), and TUJ1 (rabbit). Cy5, FITC, and Cy3-conjugated goat antibodies to IgG1 mouse, IgG2a mouse and IgG rabbit, respectively, were used as secondary antibodies.
  • 32
    • 0343908391 scopus 로고    scopus 로고
    • note
    • The cells were labeled with BrdU (Boehringer Mannheim, Indianapolis, IN) at final concentration 10 μm for 24 hours. After the labeling, depending on the specific experiment, the cells were either fixed immediately in 4% paraformaldehyde/0.15% picric acid, treated with 95% ethanol/5% glacial acidic acid for 15 min at room temperature, and subjected to immunocytochemistry, or they were cultured for various lengths of time and then analyzed by immunocytochemistry.
  • 34
    • 0343472638 scopus 로고    scopus 로고
    • note
    • 3, and 0.1% bovine serum albumin at 37°C. Inhibitors of insulin secretion (nifedipine and diazoxide) were added to the incubation buffer 30 min before addition of glucose. For determination of total cellular insulin content, insulin was extracted from cells with acid ethanol (10% glacial acetic acid in absolute ethanol) overnight at 4°C, followed by cell sonication. Total cellular and secreted insulin was assayed using insulin enzyme-linked immunosorbence assay (ELISA) kit (ALP-CO, Windham, NH). Protein concentrations were determined using DC protein assay system (Bio-Rad, Hercules, CA).
  • 41
    • 0342602581 scopus 로고    scopus 로고
    • note
    • 2+ and with 3 mM EDTA for 5 min at 37°C. Each experimental group consisted of five to eight animals per group. The animals were killed at different times, and the grafts were excised and fixed in 4% paraformaldehyde/0.15% picric acid in PBS. Sections of the grafts (15 to 20 μm) were analyzed by immunohistochemistry.
  • 43
    • 0033979603 scopus 로고    scopus 로고
    • B. Soria et al., Diabetes 49, 157 (2000).
    • (2000) Diabetes , vol.49 , pp. 157
    • Soria, B.1
  • 48
    • 0343036810 scopus 로고    scopus 로고
    • note
    • We thank T. Doetschman for gift of E14.1 ES cells and A. Nagy for gift of B5 ES cells. We also thank C. Smith for her help with confocal microscopy and J.-H. Kim for alkaline phosphatase analysis of ES cells. I.V. was supported by a fellowship from the PEW charitable Trust. We thank the National Parkinsons Foundation for their support of our work and C. Gerfen for many positive contributions.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.