메뉴 건너뛰기




Volumn 288, Issue 5473, 2000, Pages 2013-2018

Gene targeting by homologous recombination in Drosophila

Author keywords

[No Author keywords available]

Indexed keywords

DNA;

EID: 0034674713     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.288.5473.2013     Document Type: Article
Times cited : (493)

References (48)
  • 12
    • 0023058299 scopus 로고
    • L. Colleaux et al., Cell 44, 521 (1986).
    • (1986) Cell , vol.44 , pp. 521
    • Colleaux, L.1
  • 17
    • 0023665624 scopus 로고
    • The 18-bp I-Scel cut site (termed I-site here) (13) was synthesized as two oligonucleotides, GGCCGCTAGGGATAACAGGGTAATGTAC and ATTACCCTGTTATCCCTAGC, that were allowed to anneal to each other and cloned between Not I and Kpn I of plasmid pw8 [R. Klemenz, U. Weber, W. J. Gehring, Nucleic Acids Res. 15, 3947 (1987)]. This generated pP[w8, I-site], the tester construct of Fig. 1A. The same synthetic I-site was cloned between the Not I and Kpn I sites of pP[X97] (39) to generate pP[X97, I-site]. Each of these constructs was transformed by standard P element-mediated techniques. The FRT-flanked portion of P[X97, I-site] was mobilized to the RS3r-4A element on chromosome 2 and to the RS3r-2 element on chromosome 3 by FLP-mediated DNA mobilization (39), generating the tester construct of Fig. 1B in two different locations.
    • (1987) Nucleic Acids Res. , vol.15 , pp. 3947
    • Klemenz, R.1    Weber, U.2    Gehring, W.J.3
  • 18
    • 0342462731 scopus 로고    scopus 로고
    • note
    • + loss is measured as the fraction of progeny receiving the reporter chromosome that were white-eyed. For the reporter P[w8, I-site], the results of Fig. 1A are the summed results of testing five independent insertions of the reporter that were located on chromosome X, 2, or 3. For the reporter of Fig. 1B, two independent insertions were tested.
  • 33
    • 0342462726 scopus 로고    scopus 로고
    • note
    • For the targeting screen (Fig. 3A), flies with the appropriate genotypes were generated by crossing, heat-shocked during the first 3 days of development, and test-crossed as indicated. Female germ line targeting used two or three females by four males per vial; male germ line targeting used two or three males by four females. In separate experiments, we used one of two transformant lines of the donor construct P[y-donor] that were both located on chromosome 3. We used insertions of 70I-Scel and 70FLP that were located on chromosome 2.
  • 35
    • 0342896793 scopus 로고    scopus 로고
    • note
    • 2 (2 df) = 25.6]. In some cases, events from the same vial were molecularly distinct and are reported as independent events.
  • 36
    • 0342896792 scopus 로고    scopus 로고
    • note
    • In addition to Sal I digests for Southern blot analysis, we also carried out Southern blotting after digestion of genomic DNA with Sph I and Eco RI (29).
  • 39
    • 0034708480 scopus 로고    scopus 로고
    • M. D. Adams et al., Science 287, 2185 (2000).
    • (2000) Science , vol.287 , pp. 2185
    • Adams, M.D.1
  • 48
    • 0342462721 scopus 로고    scopus 로고
    • note
    • We thank M. Golic and S. Titen for technical assistance, M. Jasin for plasmid pCMV/SCE1XNLS, P. Geyer for plasmid pS/G, E. Raff for the 5-kb genomic fragment of β2t and for plasmid p[β3*] + 3′UTR, and the University of Utah Core Facilities for oligonucleotide synthesis and DNA sequencing. Supported by the University of Utah Research Foundation and by NIH grant R21GM57792.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.