Synaptic assembly of the brain in the absence of neurotransmitter secretion

Science

Volumn 287, Issue 5454, 2000, Pages 864-869

  Verhage, Matthijs ^a   Maia, Ascanio S ^a   Plomp, Jaap J ^a   Brussaard, Arjen B ^a   Heeroma, Joost H ^a   Vermeer, Hendrika ^a   Toonen, Ruud F ^a   Hammer, Robert E ^a   Van Den Berg, Timo K ^a   Missler, Markus ^a   Geuze, Hans J ^a   Südhof, Thomas C ^a  

^a NONE

Author keywords

[No Author keywords available]

Indexed keywords

ANIMAL EXPERIMENT; ANIMAL TISSUE; ARTICLE; BRAIN FUNCTION; MOUSE; NERVE FIBER GROWTH; NERVE TRACT; NEUROTRANSMITTER RELEASE; NONHUMAN; PRIORITY JOURNAL; SYNAPTIC TRANSMISSION;

ANIMALS; APOPTOSIS; BRAIN; CELL DIFFERENTIATION; CELL DIVISION; GENE DELETION; GROWTH CONES; MICE; MICE, KNOCKOUT; MUNC18 PROTEINS; NERVE DEGENERATION; NERVE TISSUE PROTEINS; NEURAL PATHWAYS; NEUROMUSCULAR JUNCTION; NEURONS; NEUROTRANSMITTER AGENTS; PATCH-CLAMP TECHNIQUES; SYNAPSES; SYNAPTIC TRANSMISSION; SYNAPTIC VESICLES; VESICULAR TRANSPORT PROTEINS;

ANIMALIA;

EID: 0034603030     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.287.5454.864     Document Type: Article

References (50)

1. G. M. Sheperd, The Synaptic Organization of the Brain (Oxford Univ. Press, New York, ed. 3, 1990). R. Keynes and G. M. W. Cook, Cell 83, 161 (1995); C. S. Goodman, Annu. Rev. Neurosci. 19, 341 (1996); M. Tessier-Lavigne and C. S. Goodman, Science 274, 1123 (1996).
2. G. M. Sheperd, The Synaptic Organization of the Brain (Oxford Univ. Press, New York, ed. 3, 1990). R. Keynes and G. M. W. Cook, Cell 83, 161 (1995); C. S. Goodman, Annu. Rev. Neurosci. 19, 341 (1996); M. Tessier-Lavigne and C. S. Goodman, Science 274, 1123 (1996).
3. G. M. Sheperd, The Synaptic Organization of the Brain (Oxford Univ. Press, New York, ed. 3, 1990). R. Keynes and G. M. W. Cook, Cell 83, 161 (1995); C. S. Goodman, Annu. Rev. Neurosci. 19, 341 (1996); M. Tessier-Lavigne and C. S. Goodman, Science 274, 1123 (1996).
4. G. M. Sheperd, The Synaptic Organization of the Brain (Oxford Univ. Press, New York, ed. 3, 1990). R. Keynes and G. M. W. Cook, Cell 83, 161 (1995); C. S. Goodman, Annu. Rev. Neurosci. 19, 341 (1996); M. Tessier-Lavigne and C. S. Goodman, Science 274, 1123 (1996).
5. S. Catsicas, G. Grenningloh, E. M. Pich, Trends Neurosci. 17, 368 (1994); A. Osen-Sand et al., J. Comp. Neurol. 367, 222 (1996); L. C. Williamson and E. A. Neale, J. Neurosci. Res. 52, 569 (1998).
6. S. Catsicas, G. Grenningloh, E. M. Pich, Trends Neurosci. 17, 368 (1994); A. Osen-Sand et al., J. Comp. Neurol. 367, 222 (1996); L. C. Williamson and E. A. Neale, J. Neurosci. Res. 52, 569 (1998).
7. S. Catsicas, G. Grenningloh, E. M. Pich, Trends Neurosci. 17, 368 (1994); A. Osen-Sand et al., J. Comp. Neurol. 367, 222 (1996); L. C. Williamson and E. A. Neale, J. Neurosci. Res. 52, 569 (1998).
8. T. L. Fletcher, P. L. Cameron, P. De Camilli, G. Banker, J. Neurosci. 11, 1617 (1991); C. Daly and E. B. Ziff, J. Neurosci. 17, 2365 (1997).
9. T. L. Fletcher, P. L. Cameron, P. De Camilli, G. Banker, J. Neurosci. 11, 1617 (1991); C. Daly and E. B. Ziff, J. Neurosci. 17, 2365 (1997).
10. M. Matteoli, K. Takei, M. S. Perin, T. C. Südhof, P. De Camilli, J. Cell Biol. 117, 849 (1992); M. Igarashi, M. Tagaya, Y. Komiya, J. Neurosci. 17, 1460 (1997); A. Osen-Sand et al., Nature 364, 445 (1993).
11. M. Matteoli, K. Takei, M. S. Perin, T. C. Südhof, P. De Camilli, J. Cell Biol. 117, 849 (1992); M. Igarashi, M. Tagaya, Y. Komiya, J. Neurosci. 17, 1460 (1997); A. Osen-Sand et al., Nature 364, 445 (1993).
12. M. Matteoli, K. Takei, M. S. Perin, T. C. Südhof, P. De Camilli, J. Cell Biol. 117, 849 (1992); M. Igarashi, M. Tagaya, Y. Komiya, J. Neurosci. 17, 1460 (1997); A. Osen-Sand et al., Nature 364, 445 (1993).
13. Y. A. Sun and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 84, 2540 (1987); Z. P. Xie and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 83, 7069 (1986); S. Coco, C. Verderio, P. De Camilli, M. Matteoli, J. Neurochem. 71, 1987 (1998).
14. Y. A. Sun and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 84, 2540 (1987); Z. P. Xie and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 83, 7069 (1986); S. Coco, C. Verderio, P. De Camilli, M. Matteoli, J. Neurochem. 71, 1987 (1998).
15. Y. A. Sun and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 84, 2540 (1987); Z. P. Xie and M.-M. Poo, Proc. Natl. Acad. Sci. U.S.A. 83, 7069 (1986); S. Coco, C. Verderio, P. De Camilli, M. Matteoli, J. Neurochem. 71, 1987 (1998).
16. T. C. Südhof, Nature 375, 645 (1995); N. Calakos and R. H. Scheller, Physiol. Rev. 76, 1 (1996).
17. T. C. Südhof, Nature 375, 645 (1995); N. Calakos and R. H. Scheller, Physiol. Rev. 76, 1 (1996).
18. R. Fernandez-Chacon and T. C. Südhof, Annu. Rev. Physiol. 61, 753 (1999).
19. M. Geppert et al., Cell 79, 717 (1994); I. Augustin, C. Rosenmund, T. C. Südhof, N. Brose, Nature 400, 457 (1999).
20. M. Geppert et al., Cell 79, 717 (1994); I. Augustin, C. Rosenmund, T. C. Südhof, N. Brose, Nature 400, 457 (1999).
21. Munc18-1 is also called Munc18a, N-sec1, or Rb-sec1 [Y. Hata, C. A. Slaughter, T. C. Südhof Nature 366, 347 (1993); Y. Hata and T. C. Südhof, J. Biol. Chem. 270, 13022 (1995); J. Pevsner, S. C. Hsu, R. H. Scheller, Proc. Natl. Acad. Sci. U.S.A. 91, 1445 (1994); E. P. Garcia, E. Gatti, M. Butler, J. Burton, P. De Camilli, Proc. Natl. Acad. Sci. U.S.A. 91, 2003 (1994); J. T. Tellam, S. McIntosh, D. E. James, J. Biol. Chem. 270, 5857 (1995)].
22. Munc18-1 is also called Munc18a, N-sec1, or Rb-sec1 [Y. Hata, C. A. Slaughter, T. C. Südhof Nature 366, 347 (1993); Y. Hata and T. C. Südhof, J. Biol. Chem. 270, 13022 (1995); J. Pevsner, S. C. Hsu, R. H. Scheller, Proc. Natl. Acad. Sci. U.S.A. 91, 1445 (1994); E. P. Garcia, E. Gatti, M. Butler, J. Burton, P. De Camilli, Proc. Natl. Acad. Sci. U.S.A. 91, 2003 (1994); J. T. Tellam, S. McIntosh, D. E. James, J. Biol. Chem. 270, 5857 (1995)].
23. Munc18-1 is also called Munc18a, N-sec1, or Rb-sec1 [Y. Hata, C. A. Slaughter, T. C. Südhof Nature 366, 347 (1993); Y. Hata and T. C. Südhof, J. Biol. Chem. 270, 13022 (1995); J. Pevsner, S. C. Hsu, R. H. Scheller, Proc. Natl. Acad. Sci. U.S.A. 91, 1445 (1994); E. P. Garcia, E. Gatti, M. Butler, J. Burton, P. De Camilli, Proc. Natl. Acad. Sci. U.S.A. 91, 2003 (1994); J. T. Tellam, S. McIntosh, D. E. James, J. Biol. Chem. 270, 5857 (1995)].
24. Munc18-1 is also called Munc18a, N-sec1, or Rb-sec1 [Y. Hata, C. A. Slaughter, T. C. Südhof Nature 366, 347 (1993); Y. Hata and T. C. Südhof, J. Biol. Chem. 270, 13022 (1995); J. Pevsner, S. C. Hsu, R. H. Scheller, Proc. Natl. Acad. Sci. U.S.A. 91, 1445 (1994); E. P. Garcia, E. Gatti, M. Butler, J. Burton, P. De Camilli, Proc. Natl. Acad. Sci. U.S.A. 91, 2003 (1994); J. T. Tellam, S. McIntosh, D. E. James, J. Biol. Chem. 270, 5857 (1995)].
25. Munc18-1 is also called Munc18a, N-sec1, or Rb-sec1 [Y. Hata, C. A. Slaughter, T. C. Südhof Nature 366, 347 (1993); Y. Hata and T. C. Südhof, J. Biol. Chem. 270, 13022 (1995); J. Pevsner, S. C. Hsu, R. H. Scheller, Proc. Natl. Acad. Sci. U.S.A. 91, 1445 (1994); E. P. Garcia, E. Gatti, M. Butler, J. Burton, P. De Camilli, Proc. Natl. Acad. Sci. U.S.A. 91, 2003 (1994); J. T. Tellam, S. McIntosh, D. E. James, J. Biol. Chem. 270, 5857 (1995)].
26. M. Verhage et al., Neuron 18, 453 (1997); M. Okamoto and T. C. Südhof, J. Biol. Chem. 272, 31459 (1997); S. Butz, M. Okamoto, T. C. Südhof, Cell 94, 773 (1998).
27. M. Verhage et al., Neuron 18, 453 (1997); M. Okamoto and T. C. Südhof, J. Biol. Chem. 272, 31459 (1997); S. Butz, M. Okamoto, T. C. Südhof, Cell 94, 773 (1998).
28. M. Verhage et al., Neuron 18, 453 (1997); M. Okamoto and T. C. Südhof, J. Biol. Chem. 272, 31459 (1997); S. Butz, M. Okamoto, T. C. Südhof, Cell 94, 773 (1998).
29. Two murine genomic munc18-1 clones in λ-FIX were used to construct a targeting vector to replace five exons of the munc18-1 gene by a neomycin resistance gene flanked by an 11.5-kb long arm and a 1.4-kb short arm, which in turn is flanked by two copies of the Herpes simplex thymidine kinase gene. Embryonic stem (ES) cells ("G-cells", gift of J. Herz, Dallas, TX) were electroporated [T. W. Rosahl et al., Cell 75, 661 (1993)] and analyzed by polymerase chain reaction (PCR) with oligonucleotide A (outside sense primer CGGTACTTGGGGATTGAACCCAGGC), oligonucleotide B (neomycin antisense primer to detect the mutant allele GGATGCGGTGGGCTCTATG-GCTTCTGA), and oligonucleotide C (inside antisense primer to detect the wild-type allele AAAGGAA-CGGGGTGGAGGGAGAGA). Homologously recombined clones were confirmed by Southern blotting with outside probes (A and B in Fig. 1A). Two positive ES cell clones were injected into blastocysts, generating highly chimeric mice that transmitted the mutation through the germ line. The genotypes of litters from heterozygote matings exhibited a Mendelian distribution.
30. Throughout this study, mouse embryos were obtained by caesarean section of pregnant females from timed heterozygous matings. Littermates were analyzed without prior genotyping. Null mutant animals had a beating heart until birth. Data from wild-type and heterozygous embryos were pooled as the control group after pilot experiments revealed no differences between these groups. Animals were housed and bred according to institutional, Dutch, and U.S. governmental guidelines.
31. N. König, G. Roch, R. Marty, Anat. Embryol. 148, 73 (1975).
32. 4 in 0.1 M cacodylate buffer; dehydrated; and embedded in epoxy resin. Ultrathin (90 nm) sections were contrasted with uranyl acetate and lead citrate. Synapses were defined as structures containing one or more 30- to 50-nm vesicles in the vicinity of a pre- and postsynaptic specialization.
33. Cortical slices (400 μm) at E17 and E18 were prepared on a Campden vibratome, and whole cell recordings were performed in situ at 33°C and a holding potential of -70 mV [A. B. Brussaard et al., Neuron 19, 1103 (1997)] . Neuromuscular junction recordings were performed on diaphragm nerve and muscle preparations at E15, E16, and E18 using 30- to 40-megohm glass capillary microelectrodes at 26° to 28°C [J. J. Plomp, G. T. H. Van Kempen, P. C. Molenaar, J. Physiol. 478, 125 (1994)]. The phrenic nerve was stimulated with a suction electrode; responses were recorded intracellularly in muscle fibers at endplates. Thereafter, 1 μM tetrodotoxin was added to suppress spontaneous contractions of fibers, which occurred in all genotypes and interfere with the recording of spontaneous events. In control experiments, a micropipette with 1 mM carbachol and a broken tip to allow leakage was brought into the vicinity of the measuring electrode.
34. Cortical slices (400 μm) at E17 and E18 were prepared on a Campden vibratome, and whole cell recordings were performed in situ at 33°C and a holding potential of -70 mV [A. B. Brussaard et al., Neuron 19, 1103 (1997)] . Neuromuscular junction recordings were performed on diaphragm nerve and muscle preparations at E15, E16, and E18 using 30- to 40-megohm glass capillary microelectrodes at 26° to 28°C [J. J. Plomp, G. T. H. Van Kempen, P. C. Molenaar, J. Physiol. 478, 125 (1994)]. The phrenic nerve was stimulated with a suction electrode; responses were recorded intracellularly in muscle fibers at endplates. Thereafter, 1 μM tetrodotoxin was added to suppress spontaneous contractions of fibers, which occurred in all genotypes and interfere with the recording of spontaneous events. In control experiments, a micropipette with 1 mM carbachol and a broken tip to allow leakage was brought into the vicinity of the measuring electrode.
35. 2 in 100% methanol for 30 min at room temperature. Sections were washed again three times in TBS and incubated for 1 hour at room temperature in 3% normal goat serum (NGS), 250 mM TBS, 1% BSA, and 0.1% Triton-X-100. For monoclonal antibodies, NGS was replaced by 1% goat anti-mouse serum. Sections were incubated at room temperature with primary antibodies overnight, with biotinylated secondary antibody for 1 hour, with peroxidase-labeled streptavidin-biotin complex for 1 hour, and with 3.3-diaminobenzidine. For the monoclonal synaptobrevin antibody, the Stemberger PAP-method was used for detection. Antibodies used were 9527 (GAP-43), CL69.1 (synaptobrevin II), and E028 (synapsins). Control experiments omitting primary antibodies confirmed staining specificity. For Fig. 58, brains were processed as in (15), sectioned at 5 μm, and post-stained with methylene blue.
36. 125I-labeled secondary antibodies [H. McMahon et al., Proc Natl. Acad. Sci. U.S.A. 93, 4760 (1996)]. To correct for degeneration in the null mutants (Figs. 4 and 5), protein levels were corrected with hexokinase, guanosine diphosphate disassociation inhibitor, and calmodulin as internal standards. Relative protein levels in knockout animals as compared to wild-type animals (100%) were as follows (mean ± SEM from triplicate determinations): synaptophysin, 96 ± 14%; synaptobrevin II, 98 ± 12%; rab3A/C, 87 ± 16%; GAP-43, 95 ± 10%; and NMDA receptor, 101 ± 5% (K. J. De Vries et al., in preparation).
37. 125I-labeled secondary antibodies [H. McMahon et al., Proc Natl. Acad. Sci. U.S.A. 93, 4760 (1996)]. To correct for degeneration in the null mutants (Figs. 4 and 5), protein levels were corrected with hexokinase, guanosine diphosphate disassociation inhibitor, and calmodulin as internal standards. Relative protein levels in knockout animals as compared to wild-type animals (100%) were as follows (mean ± SEM from triplicate determinations): synaptophysin, 96 ± 14%; synaptobrevin II, 98 ± 12%; rab3A/C, 87 ± 16%; GAP-43, 95 ± 10%; and NMDA receptor, 101 ± 5% (K. J. De Vries et al., in preparation).
38. 2).
39. Axon, dendrite, and soma morphology were from A. S. Maia, H. J. Geuze, and M. Verhage, unpublished observations.
40. J. R. Sanes and J. W. Lichtman, Annu. Rev. Neurosci. 22, 389 (1999).
41. S. DeLaPorte et al., Eur. J. Neurosci. 10, 1631 (1998)
42. Acetylcholine receptors and acetylcholinesterase were analyzed in whole-mount diaphragm neuromuscular junctions at E18. Diaphragms were fixed (for 90 min in 2% paraformaldehyde in PBS) and rinsed (for 30 min in 0.1 M glycine in PBS). After 15 min of preincubation in 0.5% Triton X-100 and 1% bovine serum albumin (BSA) in PBS, tetramethyl rhodamine isothiocyanate-labeled α-bungarotoxin (1 μg/ml) was added, and diaphragms were incubated overnight at 4°C. Diaphragms were washed, mounted in Dabco-Mowiol, and analyzed with confocal laser microscopy. Acetylcholinesterase was stained in unfixed diaphragms for 1 hour with 0.5 mM 5-bromo indoxylacetate [S. J. Holt and R. F. J. Withers, Nature 170, 1012 (1952)].
43. 3+. As controls, either TUNEL enzyme or peroxidase converter enzyme was omitted.
44. 4 for 30 min, washed again, immersed in hematoxylin, and dehydrated.
45. M. Hallonet et al., Development 125, 2599 (1998); Y. Tanabe and T. M. Jessell, Science 274, 1115 (1996); A. L. Joyner, Trends Genet. 12, 15 (1996).
46. M. Hallonet et al., Development 125, 2599 (1998); Y. Tanabe and T. M. Jessell, Science 274, 1115 (1996); A. L. Joyner, Trends Genet. 12, 15 (1996).
47. M. Hallonet et al., Development 125, 2599 (1998); Y. Tanabe and T. M. Jessell, Science 274, 1115 (1996); A. L. Joyner, Trends Genet. 12, 15 (1996).
48. T. M. Gomez and N. C. Spitzer, Nature 397, 350 (1999); L. D. Milner and L. T. Landmesser, J. Neurosci. 19, 3007 (1999).
49. T. M. Gomez and N. C. Spitzer, Nature 397, 350 (1999); L. D. Milner and L. T. Landmesser, J. Neurosci. 19, 3007 (1999).
50. The authors are grateful to G. Posthuma, D. T. Nolan, R. Fernandez-Chacon, L. C. van Halewijn, L. Lundquist, T. Broers-Vendrig, E. Borowicz, I. Leznicki, and A. Roth for assistance; R. Jahn, J. Herz, B. Oestreicher, and Y. Hata for supply of materials; and J. P. H. Burbach, F. H. Lopes da Silva, M. S. Brown, and J. L. Goldstein for discussions. We are particularly grateful to W. H. Gispen for his help and support. Supported by the Netherlands Organization for Scientific Research (NWO), the Keck Foundation, the Perot Family Foundation, and the David de Wied Foundation.