Pharmacological rescue of mutant p53 conformation and function

Science

Volumn 286, Issue 5449, 1999, Pages 2507-2510

  Foster, Barbara A ^a   Coffey, Heather A ^a   Morin, Michael J ^a   Rastinejad, Farzan ^a  

^a PFIZER INC   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

ANTINEOPLASTIC AGENT; PROTEIN P53;

ANIMAL EXPERIMENT; ANIMAL MODEL; ARTICLE; CANCER INHIBITION; DNA BINDING; DRUG MECHANISM; GENE MUTATION; GENETIC TRANSCRIPTION; MOUSE; NONHUMAN; PRIORITY JOURNAL; PROTEIN CONFORMATION; TUMOR SUPPRESSOR GENE;

ANIMALS; ANTINEOPLASTIC AGENTS; DNA; EPITOPES; GENES, P53; HUMANS; MICE; MUTATION; NEOPLASM TRANSPLANTATION; NEOPLASMS, EXPERIMENTAL; PROTEIN CONFORMATION; PROTEIN FOLDING; PROTEIN STRUCTURE, TERTIARY; PYRIMIDINES; TEMPERATURE; TRANSCRIPTION, GENETIC; TRANSFECTION; TRANSPLANTATION, HETEROLOGOUS; TUMOR CELLS, CULTURED; TUMOR SUPPRESSOR PROTEIN P53;

ANIMALIA;

EID: 0033601370     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.286.5449.2507     Document Type: Article

References (34)

1. M. Hollstein et al., Nucleic Acids Res. 22, 3551 (1994); M. R. Rosenfeld et al., Neurology 45, 1533 (1995); L. L. Nielsen et al., Cancer Gene Ther. 4, 129 (1997); P. M. O'Connor et al., Cancer Res. 57, 4285 (1997).
2. M. Hollstein et al., Nucleic Acids Res. 22, 3551 (1994); M. R. Rosenfeld et al., Neurology 45, 1533 (1995); L. L. Nielsen et al., Cancer Gene Ther. 4, 129 (1997); P. M. O'Connor et al., Cancer Res. 57, 4285 (1997).
3. M. Hollstein et al., Nucleic Acids Res. 22, 3551 (1994); M. R. Rosenfeld et al., Neurology 45, 1533 (1995); L. L. Nielsen et al., Cancer Gene Ther. 4, 129 (1997); P. M. O'Connor et al., Cancer Res. 57, 4285 (1997).
4. M. Hollstein et al., Nucleic Acids Res. 22, 3551 (1994); M. R. Rosenfeld et al., Neurology 45, 1533 (1995); L. L. Nielsen et al., Cancer Gene Ther. 4, 129 (1997); P. M. O'Connor et al., Cancer Res. 57, 4285 (1997).
5. S. E. Kern et al., Science 252, 1708 (1991); J. Milner and J. V. Watson, Oncogene 5, 1683 (1990); T. D. Halazonetis, L. J. Davis, A. N. Kandil, EMBO J. 12, 1021 (1993).
6. S. E. Kern et al., Science 252, 1708 (1991); J. Milner and J. V. Watson, Oncogene 5, 1683 (1990); T. D. Halazonetis, L. J. Davis, A. N. Kandil, EMBO J. 12, 1021 (1993).
7. S. E. Kern et al., Science 252, 1708 (1991); J. Milner and J. V. Watson, Oncogene 5, 1683 (1990); T. D. Halazonetis, L. J. Davis, A. N. Kandil, EMBO J. 12, 1021 (1993).
8. Y. Cho, S. Gorina, P. D. Jeffrey, N. P. Pavletich, Science 265, 346 (1994).
9. N. Bullock et al., Proc. Natl. Acad. Sci. U.S.A. 94, 14338 (1997); P. Friedlander, Y. Legros, T. Soussi, C. Prives, J. Biol. Chem. 271, 25468 (1996).
10. N. Bullock et al., Proc. Natl. Acad. Sci. U.S.A. 94, 14338 (1997); P. Friedlander, Y. Legros, T. Soussi, C. Prives, J. Biol. Chem. 271, 25468 (1996).
11. J. Gamble and J. Milner, Virology 162, 452 (1988); E. H. Wang, P. N. Friedman, C. Prives, Cell 57, 379 (1989); P. Hainaut and J. Milner, EMBO J. 11, 3513 (1992); Y. Legros et al., Oncogene 9, 3689 (1994); D. A. Daniels and D. P. Lane, J. Mol. Biol. 243, 639 (1994).
12. J. Gamble and J. Milner, Virology 162, 452 (1988); E. H. Wang, P. N. Friedman, C. Prives, Cell 57, 379 (1989); P. Hainaut and J. Milner, EMBO J. 11, 3513 (1992); Y. Legros et al., Oncogene 9, 3689 (1994); D. A. Daniels and D. P. Lane, J. Mol. Biol. 243, 639 (1994).
13. J. Gamble and J. Milner, Virology 162, 452 (1988); E. H. Wang, P. N. Friedman, C. Prives, Cell 57, 379 (1989); P. Hainaut and J. Milner, EMBO J. 11, 3513 (1992); Y. Legros et al., Oncogene 9, 3689 (1994); D. A. Daniels and D. P. Lane, J. Mol. Biol. 243, 639 (1994).
14. J. Gamble and J. Milner, Virology 162, 452 (1988); E. H. Wang, P. N. Friedman, C. Prives, Cell 57, 379 (1989); P. Hainaut and J. Milner, EMBO J. 11, 3513 (1992); Y. Legros et al., Oncogene 9, 3689 (1994); D. A. Daniels and D. P. Lane, J. Mol. Biol. 243, 639 (1994).
15. J. Gamble and J. Milner, Virology 162, 452 (1988); E. H. Wang, P. N. Friedman, C. Prives, Cell 57, 379 (1989); P. Hainaut and J. Milner, EMBO J. 11, 3513 (1992); Y. Legros et al., Oncogene 9, 3689 (1994); D. A. Daniels and D. P. Lane, J. Mol. Biol. 243, 639 (1994).
16. J. Bartek, R. Iggo, J. Gannon, D. P. Lane, Oncogene 5, 893 (1990); C. W. Stephen and D. P. Lane, J. Mol. Biol. 225, 577 (1992).
17. J. Bartek, R. Iggo, J. Gannon, D. P. Lane, Oncogene 5, 893 (1990); C. W. Stephen and D. P. Lane, J. Mol. Biol. 225, 577 (1992).
18. T. R. Hupp, A. Sparks, D. P. Lane, Cell 83, 237 (1995); G. Selivanova et al., Nature Med. 3, 632 (1997).
19. T. R. Hupp, A. Sparks, D. P. Lane, Cell 83, 237 (1995); G. Selivanova et al., Nature Med. 3, 632 (1997).
20. B. A. Foster, H. A. Coffey, M. J. Morin, F. Rastinejad, data not shown.
21. N. P. Pavletich, K. A. Chambers, C. O. Pabo, Genes Dev. 7, 2556 (1993).
22. J. Y. Chen, W. D. Funk, W. E. Wright, J. W. Shay, J. D. Minna, Oncogens 8, 2159 (1993).
23. S. B. Prusiner, Science 278, 243 (1997); G. Taubes, Science 271, 1493 (1996); G. J. Miroy el al., Proc. Natl. Acad. Sci. U.S.A. 93, 15051 (1996); S. Sato, C. L. Ward, M. E. Krause, J. J. Wine, R. R. Kopito, J. Biol. Chem. 271, 635 (1996).
24. S. B. Prusiner, Science 278, 243 (1997); G. Taubes, Science 271, 1493 (1996); G. J. Miroy el al., Proc. Natl. Acad. Sci. U.S.A. 93, 15051 (1996); S. Sato, C. L. Ward, M. E. Krause, J. J. Wine, R. R. Kopito, J. Biol. Chem. 271, 635 (1996).
25. S. B. Prusiner, Science 278, 243 (1997); G. Taubes, Science 271, 1493 (1996); G. J. Miroy el al., Proc. Natl. Acad. Sci. U.S.A. 93, 15051 (1996); S. Sato, C. L. Ward, M. E. Krause, J. J. Wine, R. R. Kopito, J. Biol. Chem. 271, 635 (1996).
26. S. B. Prusiner, Science 278, 243 (1997); G. Taubes, Science 271, 1493 (1996); G. J. Miroy el al., Proc. Natl. Acad. Sci. U.S.A. 93, 15051 (1996); S. Sato, C. L. Ward, M. E. Krause, J. J. Wine, R. R. Kopito, J. Biol. Chem. 271, 635 (1996).
27. -1 and diluted before use. The wells were rinsed with 25 mM Hepes (pH 6.8) and 150 mM KCl, compound or diluted DMSO vehicle was added, and the plates were incubated at the indicated temperatures. Incubation was terminated by placing the wells on ice, and the enzyme-linked immunosorbent assays were performed on ice to avoid further alterations of the epitopes. Wells were blocked for 1 hour with cold 5% skim milk in Hepes-KCl buffer before addition of the primary antibodies. Monoclonal antibodies mAb1620 and mAb240 (Calbiochem, San Diego, CA) and antibody to FLAG M2 (Sigma, St. Louis) were diluted at 1:100 to 1:250 in Hepes-KCl and added at 100 μl per well for 30 min. The plates were rinsed twice with cold Hepes-KCl buffer and incubated with horseradish peroxidase (HRP)-conjugated antibody to mouse immunoglobulin G (IgG; Roc̀he, Indianapolis) for another 30 min. The HRP signal was developed with 3,3′,5,5′-tetramethylbenzidine (TMB) developer (Pierce), and the optical density of the signal was read on a Bio-Rad microplate reader set at 450 nm.
28. Cell lines were obtained from the American Type Culture Collection (Manassas, VA) and grown in the recommended media with 10% fetal bovine serum. Cells were transfected with expression plasmids encoding the 173A mutant p53 and a neomycin selectable marker with N-[2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) transfection reagent (Roche). Transfected clones were selected for growth in media containing G418.
29. -1 in 0.05 M carbonate buffer (pH 9.6). The wells were washed with cold phosphate-buffered saline (PBS), blocked for 3 hours at 4°C with 4% skim milk in PBS, and probed with HRP-conjugated mAb1620 antibody in skim milk. The antibody incubation was for 1 hour on ice, after which wells were washed three times in PBS with 0.05% Tween 20, and TMB substrate was used to develop the signal. A standard curve was established with the lysate from temperature-shifted (32°C) cells that expressed large quantities of 1620-positive p53. Quantitation of the samples was within the linear range of the standard curve and was corrected for total p53 in each sample as well as for the 1620-positive p53 fraction in untreated cell lysates.
30. Cells were transfected with a plasmid encoding the hygromycin resistance marker and a p53 reporter gene made up of four copies of a p53-binding sequence (GCCTTGCCTGGACTTGCCTGGCCTTGCCTTTTC) placed upstream of the simian virus 40 basal promoter driving the luciferase gene. Transfected clones were selected for growth in Hygromycin and subsequently transfected with the mutant p53 as above. Monolayers of cells in 96-well tissue culture plates were treated with compound, and luciferase activity was determined with a substrate conversion assay (Promega, Madison, WI) and quantified with a Dynatech microplate luminometer.
31. -1; Roche). Protein concentrations were determined with Bradford reagent (Bio-Rad, Hercules, CA), and 10 μg of cell lysate was loaded onto 8 to 16% gradient polyacrylamide-SDS gels (Novex, San Diego, CA). Proteins were transferred onto Immobilon P membrane (Millipore, Marlborough, MA). Membranes were bisected between the 32.5-and 47.5-kD molecular mass markers and blocked for 1 hour at room temperature in SuperBlock (Pierce) plus 3% skim milk. The bottom half of the blot was probed for p21 expression with monoclonal antibody clone EA10 (Calbiochem), and the top half of the blot was probed for total p53 expression with mAbDO-1 (Calbiochem). The blots were washed for 1 hour in three changes of tris-buffered saline with 0.1% Tween 20, before the addition of a secondary antibody, HRP-conjugated antibody to mouse IgG. The bands were visualized with Renaissance ECL (DuPont, Boston) and exposure to Hyperfilm ECL (Amersham, Arlington Heights, IL).
32. 6 DLD1 cells were inoculated in 90% Matrigel (Becton Dickinson, Franklin Lakes, NJ) unilaterally into the right flanks of ∼20-g female NU/NU-nuBR mice (Charles River Laboratories, Wilmington, MA). CP-31398 was administered intraperitoneally in a saline solution with 0.1% Pluronic P-105 (BASF, Parsippany, NJ) as the vehicle. Tumor diameter was measured in two dimensions with calipers and converted to tumor volume. The care of animals was in accordance with institutional guidelines.
33. D. M. Euhus, C. Hudd, M. C. LaRegina, F. E. Johnson, J. Surg. Oncol. 31, 229 (1986).
34. We thank G. Borzillo, N. Bouck, J. Chin, J. Lyssikatos, N. Pavletich, S. Sobolov, and members of the Pfizer cancer biology group for reagents and critical discussions of this work.