Genetic dissection of a mammalian replicator in the human β-globin locus

Science

Volumn 281, Issue 5379, 1998, Pages 1005-1009

  Aladjem, Mirit I ^a   Rodewald, Luo Wei ^a   Kolman, John L ^a   Wahl, Geoffrey M ^a  

^a SALK INSTITUTE FOR BIOLOGICAL STUDIES   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

BETA GLOBULIN;

ANIMAL CELL; ARTICLE; DNA REPLICATION; DNA SEQUENCE; GENE DELETION; GENE LOCUS; GENOME; HUMAN; MONKEY; NONHUMAN; PRIORITY JOURNAL; REPLICON;

ANIMALS; CELL LINE; CERCOPITHECUS AETHIOPS; DNA; DNA NUCLEOTIDYLTRANSFERASES; DNA REPLICATION; GENE TARGETING; GLOBINS; HUMANS; INTEGRASES; POLYMERASE CHAIN REACTION; REPLICATION ORIGIN; S PHASE; SEQUENCE DELETION; VIRAL PROTEINS;

ANIMALIA; EUKARYOTA; MAMMALIA; SIMIAE;

EID: 0032516695     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: None     Document Type: Article

References (69)

1. A. Almasan, S. Linke, T. Paulson, L. Huang, G. Wahl, Cancer Metastasis Rev. 14, 59 (1995); K. A. Nasmyth, Science 274, 1643 (1996).
2. A. Almasan, S. Linke, T. Paulson, L. Huang, G. Wahl, Cancer Metastasis Rev. 14, 59 (1995); K. A. Nasmyth, Science 274, 1643 (1996).
3. F. Jacob, J. Brenner, F. Cuzin, Cold Spring Harbor Symp. Quant. Biol. 288, 329 (1964).
4. D. Bramhill and A. Kornberg, Cell 54, 915 (1988).
5. M. D. Challberg and T. J. Kelly, Annu. Rev. Biochem. 58, 671 (1989).
6. S. P. Bell, Y. Marahrens, H. Rao, B. Stillman, Cold Spring Harbor Symp. Quant. Biol. 58, 435 (1993).
7. R. K. Clyne and T. J. Kelly, Methods 13, 221 (1997).
8. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
9. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
10. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
11. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
12. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
13. S. Handeli, A. Klar, M. Meuth, H. Cedar, Cell 57, 909 (1989); W. C. Burhans, L. T. Vassilev, M. S. Caddle, N. H. Heintz, M. L. DePamphilis, ibid. 62, 955 (1990); S. M. Carroll et al., Mol. Cell. Biol. 13, 2971 (1993); G. H. Nonet and G. M. Wahl, Somatic Cell Mol. Genet. 19, 171 (1993); R. E. Kelly, M. L. DeRose, B. W. Draper, G. M. Wahl, Mol. Cell. Biol. 15, 4136 (1995); W. C. Burhans and J. A. Huberman, Science 263, 639 (1994).
14. N. Shimizu, T. Kanda, G. M. Wahl, Nature Genet. 12, 65 (1996); N. Shimizu, N. Itoh, H. Utiyama, G. M. Wahl, J. Cell Biol. 140, 1307 (1998); R. Snapka and A. Varshavsky, Proc. Natl. Acad. Sci. U.S.A. 80, 7533 (1983).
15. N. Shimizu, T. Kanda, G. M. Wahl, Nature Genet. 12, 65 (1996); N. Shimizu, N. Itoh, H. Utiyama, G. M. Wahl, J. Cell Biol. 140, 1307 (1998); R. Snapka and A. Varshavsky, Proc. Natl. Acad. Sci. U.S.A. 80, 7533 (1983).
16. N. Shimizu, T. Kanda, G. M. Wahl, Nature Genet. 12, 65 (1996); N. Shimizu, N. Itoh, H. Utiyama, G. M. Wahl, J. Cell Biol. 140, 1307 (1998); R. Snapka and A. Varshavsky, Proc. Natl. Acad. Sci. U.S.A. 80, 7533 (1983).
17. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
18. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
19. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
20. R. M. Harland and R. A. D. Laskey, Cell 21, 761 (1980); M. Gilbert, H. Miyazawa, M. L. DePamphilis, Mol. Cell Biol. 15, 2942 (1995); P. Pasero, D. Braguglia, S. M. Gasser, Genes Dev. 11, 1504 (1997).
21. R. M. Harland and R. A. D. Laskey, Cell 21, 761 (1980); M. Gilbert, H. Miyazawa, M. L. DePamphilis, Mol. Cell Biol. 15, 2942 (1995); P. Pasero, D. Braguglia, S. M. Gasser, Genes Dev. 11, 1504 (1997).
22. R. M. Harland and R. A. D. Laskey, Cell 21, 761 (1980); M. Gilbert, H. Miyazawa, M. L. DePamphilis, Mol. Cell Biol. 15, 2942 (1995); P. Pasero, D. Braguglia, S. M. Gasser, Genes Dev. 11, 1504 (1997).
23. M. I. Aladjem et al., Science 270, 815 (1995).
24. B. J. Brewer and W. L. Fangman, ibid. 262, 1728 (1993).
25. S. O'Gorman, D. T. Fox, G. M. Wahl, ibid. 251, 1351 (1991); B. Sauer and N. Henderson, New Biol. 2, 441 (1990); M. I. Aladjem, L. L. Brody, S. O'Gorman, G. M. Wahl, Mol. Cell. Biol. 17, 857 (1997).
26. S. O'Gorman, D. T. Fox, G. M. Wahl, ibid. 251, 1351 (1991); B. Sauer and N. Henderson, New Biol. 2, 441 (1990); M. I. Aladjem, L. L. Brody, S. O'Gorman, G. M. Wahl, Mol. Cell. Biol. 17, 857 (1997).
27. S. O'Gorman, D. T. Fox, G. M. Wahl, ibid. 251, 1351 (1991); B. Sauer and N. Henderson, New Biol. 2, 441 (1990); M. I. Aladjem, L. L. Brody, S. O'Gorman, G. M. Wahl, Mol. Cell. Biol. 17, 857 (1997).
28. D. Kitsberg, S. Selig, I. Keshet, H. Cedar, Nature 366, 588 (1993).
29. The nascent strand abundance assay was performed as described [Y. Yoon, J. A. Sanchez, C. Brun, J. A. Huberman, Mol. Cell. Biol. 15, 2482 (1995)] with the modifications described by M. I. Aladjem et al. [Science 270, 815 (1995)]. Briefly, nascent strands were isolated as short DNA fragments (<8 kb) that incorporated bromodeoxyuridine (BrdU) during a 90-min pulse label. Short BrdU-substituted strands, isolated by density gradient centrifugation, were further fractionated by alkaline agarose gel electrophoresis. Fragments of various sizes were isolated from the gel and amplified with primers spanning the region of interest. PCR primers used were as follows: (1) Upper: AAATCTAACAGCCAAGTCAAAT; lower: AATAAAATA-AAACAATAAAATG; (2) (hβG) upper: CCTGAGGAGA AGTCTGCCGT; lower CAGTGCAGCTCACTCAGTGT; (3) (ivs) upper GGAAGGGGAGAAGTAACAGGGT; lower: AAGGGCCTAGCTTGGACTCAG; (4) upper: TATTAGC ATAGTGTTACCATCA; lower: TTCTTTATTTTTCCTTT-TGTTG; (5) upper: ATCCAAAAACTAAATCTCACA ; lower: CACCCGTCTTCTGCGTCACTC; (6) (β-Gal) upper: TTGAAAATGGTCTGCTGCTGCTGAAC; lower: CGGATA AACGGAACTGGAAAAACTGC; mitochondrial DNA, upper. TACGCTCTATTCTCGACACTCACAACAAAG; lower: GGTTTAAGAATAATGGGGGTAGTATGTAAG.
30. The nascent strand abundance assay was performed as described [Y. Yoon, J. A. Sanchez, C. Brun, J. A. Huberman, Mol. Cell. Biol. 15, 2482 (1995)] with the modifications described by M. I. Aladjem et al. [Science 270, 815 (1995)]. Briefly, nascent strands were isolated as short DNA fragments (<8 kb) that incorporated bromodeoxyuridine (BrdU) during a 90-min pulse label. Short BrdU-substituted strands, isolated by density gradient centrifugation, were further fractionated by alkaline agarose gel electrophoresis. Fragments of various sizes were isolated from the gel and amplified with primers spanning the region of interest. PCR primers used were as follows: (1) Upper: AAATCTAACAGCCAAGTCAAAT; lower: AATAAAATA-AAACAATAAAATG; (2) (hβG) upper: CCTGAGGAGA AGTCTGCCGT; lower CAGTGCAGCTCACTCAGTGT; (3) (ivs) upper GGAAGGGGAGAAGTAACAGGGT; lower: AAGGGCCTAGCTTGGACTCAG; (4) upper: TATTAGC ATAGTGTTACCATCA; lower: TTCTTTATTTTTCCTTT-TGTTG; (5) upper: ATCCAAAAACTAAATCTCACA ; lower: CACCCGTCTTCTGCGTCACTC; (6) (β-Gal) upper: TTGAAAATGGTCTGCTGCTGCTGAAC; lower: CGGATA AACGGAACTGGAAAAACTGC; mitochondrial DNA, upper. TACGCTCTATTCTCGACACTCACAACAAAG; lower: GGTTTAAGAATAATGGGGGTAGTATGTAAG.
31. M. I. Aladjem, L. W. Rodewald, J. L. Kolman, G. M. Wahl, data not shown.
32. E. Epner, W. C. Forrester, M. Groudine, Proc. Natl. Acad. Sci. U.S.A. 85, 8081 (1988).
33. V. Dhar, A. I. Skoultchi, C. L. Schildkraut, Mol. Cell. Biol. 9, 3524 (1989).
34. R. S. Hansen, T. K. Canfield, M. M. Lamb, S. M. Gartler, C. D. Laird, Cell 73, 1403 (1993).
35. PCR reaction that compared various preparations of DNAs included two controls. First, the amount of DNA in each one of the samples was normalized by the use of mitochondrial primers [(15) (S. Strehl, J. M. LaSalle, M. Lalande, Mol. Cell Biol. 17, 6157 (1997)]. Then, the efficiency of the amplification reaction in each reaction was normalized by the use of mimic competitors as described [C. Pelizon, S. Diviacco, A. Falaschi, M. Giacca, ibid. 16, 5358 (1996)]. Each competitor contains the same sequence as the expected fragment amplified from genomic DNA but is larger by 20 to 70 bp and serves as a standard to compare the abundance of genomic amplified DNA in the S phase fractions. The results of one set of experiments are shown in Fig. 2B, but the experiment was repeated twice with essentially the same results.
36. PCR reaction that compared various preparations of DNAs included two controls. First, the amount of DNA in each one of the samples was normalized by the use of mitochondrial primers [(15) (S. Strehl, J. M. LaSalle, M. Lalande, Mol. Cell Biol. 17, 6157 (1997)]. Then, the efficiency of the amplification reaction in each reaction was normalized by the use of mimic competitors as described [C. Pelizon, S. Diviacco, A. Falaschi, M. Giacca, ibid. 16, 5358 (1996)]. Each competitor contains the same sequence as the expected fragment amplified from genomic DNA but is larger by 20 to 70 bp and serves as a standard to compare the abundance of genomic amplified DNA in the S phase fractions. The results of one set of experiments are shown in Fig. 2B, but the experiment was repeated twice with essentially the same results.
37. D. D. Dubey, S.-M. Kim, I. T. Todorov, J. A. Huberman, Curr. Biol. 6, 467 (1997); J. F. Theis and C. S. Newlon, Mol. Cell. Biol. 14, 7652 (1994).
38. D. D. Dubey, S.-M. Kim, I. T. Todorov, J. A. Huberman, Curr. Biol. 6, 467 (1997); J. F. Theis and C. S. Newlon, Mol. Cell. Biol. 14, 7652 (1994).
39. Y. Marahrens and B. Stillman, Science 255, 817 (1992).
40. M. L. DePamphilis, Curr. Opin. Cell. Biol. 5, 434 (1993); T. Kobayashi, T. Rein, M. L. DePamphilis, Mol. Cell. Biol. 18, 3266 (1998).
41. M. L. DePamphilis, Curr. Opin. Cell. Biol. 5, 434 (1993); T. Kobayashi, T. Rein, M. L. DePamphilis, Mol. Cell. Biol. 18, 3266 (1998).
42. A. K. Bielinsky and S. A. Gerbi, ibid. 279, 95 (1998).
43. S. S. Heinzel, P. J. Krysan, C. T. Tran, M. P. Calos, Mol. Cell. Biol. 11, 2263 (1991).
44. B. Stillman, Science 274, 1659 (1996).
45. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell. Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
46. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell. Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
47. D. Coverley and R. Laskey, Annu. Rev. Biochem. 63, 745 (1994); J. J. Blow, J. Cell. Biol. 122, 993 (1993); J. F. Diffley, Genes Dev. 10, 2819 (1996).
48. E. Epner et al., Proc. Natl. Acad. Sci. U.S.A. 88, 153 (1991); F. Grosveld et al., Cold Spring Harbor Symp. Quant. Biol. 58, 7 (1993).
49. E. Epner et al., Proc. Natl. Acad. Sci. U.S.A. 88, 153 (1991); F. Grosveld et al., Cold Spring Harbor Symp. Quant. Biol. 58, 7 (1993).
50. J. L. Hamlin and P. A. Dijkwel, Curr. Opin. Genet. Dev. 5, 153 (1995).
51. J. L. Hamlin, personal communication.
52. W. Forrester, C. Thompson, J. Elder, M. Groudine, Proc. Natl. Acad. Sci. U.S.A. 83, 1359 (1986).
53. M. C. Walters et al., Genes Dev. 10, 185 (1996).
54. A. Kornberg and T. A. Baker, DNA Replication (Freeman, New York, 1992).
55. J. J. Li and T. J. Kelly, Mol. Cell. Biol. 5, 1238 (1985); M. L. DePamphilis, Annu. Rev. Biochem. 62, 29 (1993); B. Stillman, Cell 78, 725 (1994).
56. J. J. Li and T. J. Kelly, Mol. Cell. Biol. 5, 1238 (1985); M. L. DePamphilis, Annu. Rev. Biochem. 62, 29 (1993); B. Stillman, Cell 78, 725 (1994).
57. J. J. Li and T. J. Kelly, Mol. Cell. Biol. 5, 1238 (1985); M. L. DePamphilis, Annu. Rev. Biochem. 62, 29 (1993); B. Stillman, Cell 78, 725 (1994).
58. J. F. Diffley, Genes Dev. 10, 2819 (1996).
59. R. S. Williams, R. V. Shohet, B. Stillman, Proc. Natl. Acad. Sci. U.S.A. 94, 142 (1997).
60. D. T. Pak et al., Cell 91, 311 (1997); A. Rowles et al., ibid. 87, 287 (1996); M. Ishiai et al., Genomics 46, 294 (1997).
61. D. T. Pak et al., Cell 91, 311 (1997); A. Rowles et al., ibid. 87, 287 (1996); M. Ishiai et al., Genomics 46, 294 (1997).
62. D. T. Pak et al., Cell 91, 311 (1997); A. Rowles et al., ibid. 87, 287 (1996); M. Ishiai et al., Genomics 46, 294 (1997).
63. C. S. Newlon, Cell 91, 717 (1997).
64. J. F. Diffley, J. H. Cocker, S. J. Dowell, J. Harwood, A. Rowley, J. Cell Sci. Suppl. 19, 67 (1995).
65. Y. Yoon, J. A. Sanchez, C. Brun, J. A. Huberman, Mol. Cell. Biol. 15, 2482 (1995).
66. All PCR reactions were performed in 25 μl with an initial denaturation of 2 min at 94°C, 35 cycles of 45 s denaturation at 94°C, 45 s annealing at 60°C, and 45 s extension at 72°C. Final extension (7 min) was performed at 72°C. All the reactions were performed with Taq polymerase (Boehringer Mannheim), and the salt conditions were optimized for each primer pair with the Invitrogen PCR optimizer kit. Competitor concentrations were determined by reading the absorbency of the cloned fragments at 260 nm. Because the transferred IR was inserted in simian cells, all the primer pairs were assayed for selective amplification of human, but not simian, DNA before use in this assay. PCR reactions with primers only, or with genomic or competitor DNA with no primers, yielded no product.
67. S. Strehl, J. M. LaSalle, M. Lalande, Mol. Cell Biol. 17, 6157 (1997).
68. C. Pelizon, S. Diviacco, A. Falaschi, M. Giacca, ibid. 16, 5358 (1996).
69. We thank E. Epner and M. Groudine for advice regarding the globin locus and for globin sequences and probes; S. Strehl and M. Lalande for sharing the sequence of mitochondrial primers; S. O'Gorman for advice and site-specific recombination reagents; J. Hamlin and M. DePamphilis for sharing data before publication and for insightful comments; J. A. Huberman, M. Mechali, S. Menut, R. Gellibolian, and F. E. Indig for comments on the manuscript; and L. Brody, A. Telling, C. Navarro, and S. Wilson for technical assistance. This work was supported by grants from the NIH (CA48405, GM51104) and the G. Harold and Leila Y. Mathers Charitable Foundation. M.I.A. was supported by a postdoctoral fellowship from the Human Frontiers Science Project Organization and by a special fellowship from the Leukemia Society of America.