메뉴 건너뛰기




Volumn 279, Issue 5353, 1998, Pages 1052-1054

Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis

Author keywords

[No Author keywords available]

Indexed keywords

AUTOANTIBODY; FC RECEPTOR;

EID: 0032512855     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.279.5353.1052     Document Type: Article
Times cited : (535)

References (49)
  • 22
    • 0001404232 scopus 로고    scopus 로고
    • D. J. Wallace and B. H. Hahn, Eds. Williams & Wilkins, Baltimore, MD
    • B. H. Hahn, in Dubois's Lupus Erythematosus, D. J. Wallace and B. H. Hahn, Eds. (Williams & Wilkins, Baltimore, MD, 1997), p. 69.
    • (1997) Dubois's Lupus Erythematosus , pp. 69
    • Hahn, B.H.1
  • 23
    • 6844247122 scopus 로고    scopus 로고
    • V. J. Gauthier and J. W. Emlen, in (22), p. 207
    • V. J. Gauthier and J. W. Emlen, in (22), p. 207.
  • 24
    • 6844224719 scopus 로고    scopus 로고
    • P. H. Schur, in (22), p. 245
    • P. H. Schur, in (22), p. 245.
  • 25
    • 6844232805 scopus 로고    scopus 로고
    • H. M. Belmont and S. Abramson, in (22), p. 263
    • H. M. Belmont and S. Abramson, in (22), p. 263.
  • 34
    • 6844225710 scopus 로고    scopus 로고
    • in preparation
    • Y. Suzuki et al., in preparation.
    • Suzuki, Y.1
  • 39
    • 15844412034 scopus 로고    scopus 로고
    • J. Ahearn et al., Immunity 4, 251 (1996).
    • (1996) Immunity , vol.4 , pp. 251
    • Ahearn, J.1
  • 45
    • 6844245385 scopus 로고    scopus 로고
    • note
    • +/- B/W female offspring mice. Mice were genotyped by polymerase chain reaction of tail-tip DNA samples. (Primer sequences: neo: CTCGTGCTTTACGGTATCGCC; gamma 1: ACCCTACTCTACTGTCGACTCAAG; gamma 2:TCACGGCTGGCTATAGCTGCCTT. Annealing temperature was 62°C. Knockout and wild-type amplified products were 260 and 224 base pairs, respectively).
  • 46
    • 6844238918 scopus 로고    scopus 로고
    • note
    • Urine was collected at 2-week intervals and read by dipstick (2GP Chemstrip, Boehringer-Mannheim, Indianapolis, IN). We scored 3+ determinations (5 mg/ml) as positive for proteinuria. Using metabolic cages (Fisher, Pittsburgh, PA), we obtained, 24-hour urine collections from all mice with 3+ proteinuria. Statistical analysis of proteinuria and survival data were done with the StatSoft software package (Tulsa, OK).
  • 47
    • 6844264914 scopus 로고    scopus 로고
    • note
    • +/- C57BI/6 kidneys as negative controls (28).
  • 48
    • 6844223702 scopus 로고    scopus 로고
    • note
    • +/- mice were added to enzyme-linked immunosorbent assay (ELISA) plates coated with C1q (Sigma, St. Louis, MO) for detection of ICs and to dsDNA-coated plates (United Biotech, Mountain View, CA) for detection of antibodies to chromatin. After washing away unbound serum, the appropriate rat anti-mouse IgG, IgG1, IgG2a, IgG2b, IgG3, or IgM (Pharmingen, San Diego, CA) was added. Alkaline-phosphatase-conjugated AKP polyclonal antirat IgG (Pharmingen, San Diego, CA) was used as secondary antibody. After incubation with para-nitrophenyl phosphate substrate, the samples were read spectrophotometrically at 405 nm with an ELISA reader (Molecular Devices, Sunnyvale, CA). Pooled serum from 7-month-old wild-type B/W female mice was used to generate a reference standard curve.
  • 49
    • 6844267457 scopus 로고    scopus 로고
    • note
    • We thank the Ravetch lab and M. Madaio for helpful discussions and F. Vital, D. White, and C. Ritter for technical and administrative assistance. Supported by NIH grants to J. V. R. and R. C.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.