메뉴 건너뛰기




Volumn 280, Issue 5360, 1998, Pages 101-104

Interaction of short-range repressors with Drosophila CtBP in the embryo

Author keywords

[No Author keywords available]

Indexed keywords

REPRESSOR PROTEIN; VIRUS PROTEIN;

EID: 0032478737     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.280.5360.101     Document Type: Article
Times cited : (228)

References (45)
  • 1
    • 2642661133 scopus 로고
    • M. J. Pankratz et al., Cell 61, 30 (1990); S. Small, A. Blair, M. Levine, EMBO J. 11, 4047 (1992).
    • (1990) Cell , vol.61 , pp. 30
    • Pankratz, M.J.1
  • 5
    • 0029895168 scopus 로고    scopus 로고
    • For reviews, see S. Gray and M. Levine, Curr. Opin. Cell Biol. 8, 358 (1996); Y. T. Ip and K. Hemavathy, Curr. Biol. 7, R216 (1997).
    • (1996) Curr. Opin. Cell Biol. , vol.8 , pp. 358
    • Gray, S.1    Levine, M.2
  • 6
    • 0031128336 scopus 로고    scopus 로고
    • For reviews, see S. Gray and M. Levine, Curr. Opin. Cell Biol. 8, 358 (1996); Y. T. Ip and K. Hemavathy, Curr. Biol. 7, R216 (1997).
    • (1997) Curr. Biol. , vol.7
    • Ip, Y.T.1    Hemavathy, K.2
  • 7
    • 0024412752 scopus 로고
    • M. Levine and J. L. Manley, Cell 59, 405 (1989); A. D. Johnson, ibid. 81, 655 (1995).
    • (1989) Cell , vol.59 , pp. 405
    • Levine, M.1    Manley, J.L.2
  • 8
    • 0029056537 scopus 로고
    • M. Levine and J. L. Manley, Cell 59, 405 (1989); A. D. Johnson, ibid. 81, 655 (1995).
    • (1995) Cell , vol.81 , pp. 655
    • Johnson, A.D.1
  • 10
    • 0030962902 scopus 로고    scopus 로고
    • H. N. Cai, D. N. Arnosti, M. Levine, Proc. Natl. Acad. Sci. U.S.A. 93, 9309 (1996); S. Barolo and M. Levine, EMBO J. 16, 2883 (1997).
    • (1997) EMBO J. , vol.16 , pp. 2883
    • Barolo, S.1    Levine, M.2
  • 16
    • 0030697514 scopus 로고    scopus 로고
    • T. Dubnicoff et al., ibid. 11, 2952 (1997); Z. Paroush et al., Cell 79, 805 (1994); A. L. Fisher, S. Ohsako, M. Caudy, Mol. Cell. Biol. 16, 2670 (1996); G. Jimenez, Z. Paroush, D. Ish-Horowicz, Genes Dev. 11, 3072 (1997).
    • (1997) Genes Dev. , vol.11 , pp. 2952
    • Dubnicoff, T.1
  • 17
    • 0028170530 scopus 로고
    • T. Dubnicoff et al., ibid. 11, 2952 (1997); Z. Paroush et al., Cell 79, 805 (1994); A. L. Fisher, S. Ohsako, M. Caudy, Mol. Cell. Biol. 16, 2670 (1996); G. Jimenez, Z. Paroush, D. Ish-Horowicz, Genes Dev. 11, 3072 (1997).
    • (1994) Cell , vol.79 , pp. 805
    • Paroush, Z.1
  • 18
    • 0030010697 scopus 로고    scopus 로고
    • T. Dubnicoff et al., ibid. 11, 2952 (1997); Z. Paroush et al., Cell 79, 805 (1994); A. L. Fisher, S. Ohsako, M. Caudy, Mol. Cell. Biol. 16, 2670 (1996); G. Jimenez, Z. Paroush, D. Ish-Horowicz, Genes Dev. 11, 3072 (1997).
    • (1996) Mol. Cell. Biol. , vol.16 , pp. 2670
    • Fisher, A.L.1    Ohsako, S.2    Caudy, M.3
  • 19
    • 0030701604 scopus 로고    scopus 로고
    • T. Dubnicoff et al., ibid. 11, 2952 (1997); Z. Paroush et al., Cell 79, 805 (1994); A. L. Fisher, S. Ohsako, M. Caudy, Mol. Cell. Biol. 16, 2670 (1996); G. Jimenez, Z. Paroush, D. Ish-Horowicz, Genes Dev. 11, 3072 (1997).
    • (1997) Genes Dev. , vol.11 , pp. 3072
    • Jimenez, G.1    Paroush, Z.2    Ish-Horowicz, D.3
  • 20
    • 0023761709 scopus 로고
    • U. Nauber et al., Nature 336, 489 (1988).
    • (1988) Nature , vol.336 , pp. 489
    • Nauber, U.1
  • 22
    • 0029916318 scopus 로고    scopus 로고
    • J. L. Boulay, C. Dennefeld, A. Alberga, ibid. 330, 395 (1987); S. Gray and M. Levine, Genes Dev. 10, 700 (1996).
    • (1996) Genes Dev. , vol.10 , pp. 700
    • Gray, S.1    Levine, M.2
  • 23
    • 0027509346 scopus 로고
    • J. M. Boyd et al., EMSO J. 12, 469 (1993); U. Schaeper et al., Proc. Natl. Acad. Sci. U.S.A. 92, 10467 (1995); K. Sollerbrant, G. Chinnadurai, C. Svensson, Nucleic Acids Res. 24, 2578 (1996).
    • (1993) EMSO J. , vol.12 , pp. 469
    • Boyd, J.M.1
  • 24
    • 0028838348 scopus 로고
    • J. M. Boyd et al., EMSO J. 12, 469 (1993); U. Schaeper et al., Proc. Natl. Acad. Sci. U.S.A. 92, 10467 (1995); K. Sollerbrant, G. Chinnadurai, C. Svensson, Nucleic Acids Res. 24, 2578 (1996).
    • (1995) Proc. Natl. Acad. Sci. U.S.A. , vol.92 , pp. 10467
    • Schaeper, U.1
  • 27
    • 0026009094 scopus 로고
    • D. Kosman, Y. T. Ip, M. Levine, K. Arora, Science 254, 188 (1991); M. Leptin, Genes Dev. 5, 1568 (1991).
    • (1991) Genes Dev. , vol.5 , pp. 1568
    • Leptin, M.1
  • 28
    • 2642601755 scopus 로고    scopus 로고
    • note
    • + colonies exhibiting β-galactosidase activity were sequenced using the Ladderman dideoxy sequencing kit (Takara Shuzo, Japan). The four different dCtBP cDNA clones (one using Gal4-snail and three using Gal4-knirps) were not in the same reading frame as the Gal4 activation domain in the expression vectors. However, yeast has an intrinsic frame-shifting activity, which would be expected to result in the expression of small amounts of in-frame fusion proteins (28). Retransformation of yeast Y190 strains with in-frame dCtBP expression vectors resulted in reduced growth but specific interaction with the Knirps and Snail expression vectors.
  • 29
    • 2642597736 scopus 로고    scopus 로고
    • Abbreviations for the amino acid residues are as follows; A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr
    • Abbreviations for the amino acid residues are as follows; A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
  • 30
    • 2642595716 scopus 로고    scopus 로고
    • note
    • 35S-labeled proteins were fractionated on a 10% SDS-polyacrylamide gel and visualized by autoradiography.
  • 33
    • 2642684216 scopus 로고    scopus 로고
    • note
    • Genomic DNA was extracted from I(3)03463 heterozygous stocks, annealed with various primers, and then subjected to polymerase chain reaction (PCR) amplification using standard methods. A 550-bp DNA fragment was obtained using a 23-nucleotide primer from the 5′ end of the dCtBP cDNA (TGAAAGCTGCGAGTGGAATTTGG) and a 28-nucleotide primer from the 3′ region of the P-element (CTTGCCGACGGGACCACCTTATGTTATT). The 5′ end of this PCR product contains 37 bp of perfect identity to the 5′ end of the dCtBP UTR. The remaining sequence does not contain any discernible homology with dCtBP, which suggests that the dCtBP UTR is interrupted by an intron located 37 bp downstream of the 5′ end of the largest dCtBP cDNA. It would appear that the P-element maps within this intron.
  • 34
    • 0030455823 scopus 로고    scopus 로고
    • Additional information about I(3)03463/dCtBP can be obtained in Flybase
    • N. Perrimon, A. C. Lanjuin, C. Arnold, E. Noll, Genetics 144, 1681 (1996). Additional information about I(3)03463/dCtBP can be obtained in Flybase (http://flybase.bio.indiana.edu/.bin/fbidq. html?FBal0009468).
    • (1996) Genetics , vol.144 , pp. 1681
    • Perrimon, N.1    Lanjuin, A.C.2    Arnold, C.3    Noll, E.4
  • 36
    • 2642655995 scopus 로고    scopus 로고
    • 1118 embryos as described (3). In situ hybridizations on whole mount preparations of staged, transgenic embryos were also done as described (3) using a digoxigenin-uridine triphosphate-labeled lacZ antisense RNA probe. The stripe 2 reporter gene and Gal4 expression vector are identical to those used by Arnosti et al. (8)
    • 1118 embryos as described (3). In situ hybridizations on whole mount preparations of staged, transgenic embryos were also done as described (3) using a digoxigenin-uridine triphosphate-labeled lacZ antisense RNA probe. The stripe 2 reporter gene and Gal4 expression vector are identical to those used by Arnosti et al. (8).
  • 39
    • 0031016183 scopus 로고    scopus 로고
    • Y. Yu et al., Nature 385, 552 (1997).
    • (1997) Nature , vol.385 , pp. 552
    • Yu, Y.1
  • 43
    • 2642636530 scopus 로고    scopus 로고
    • A GST-dCtBP fusion protein containing amino acid residues 8 to 383 was injected into a rat (Pocono Rabbit Farm, PA). The preimmune serum did not detectably cross-react with fixed embryos. The GST-dCtBP antiserum specifically stained nuclei in mixed-stage embryos. Reduced staining was detected in I(3)03463 homozygous embryos. Embryos were fixed and preincubated in bovine serum albumin as described (15). The rat serum was diluted 1:1000, and dCtBP was visualized using a 1:200 dilution of tetramethyl rhodamine isothiocyanate-conjugated antibodies to rat immunoglobulin (Jackson Labs)
    • A GST-dCtBP fusion protein containing amino acid residues 8 to 383 was injected into a rat (Pocono Rabbit Farm, PA). The preimmune serum did not detectably cross-react with fixed embryos. The GST-dCtBP antiserum specifically stained nuclei in mixed-stage embryos. Reduced staining was detected in I(3)03463 homozygous embryos. Embryos were fixed and preincubated in bovine serum albumin as described (15). The rat serum was diluted 1:1000, and dCtBP was visualized using a 1:200 dilution of tetramethyl rhodamine isothiocyanate-conjugated antibodies to rat immunoglobulin (Jackson Labs).
  • 45
    • 2642593704 scopus 로고    scopus 로고
    • We thank D. Rio for help with PCR amplification, L. Pick for the yeast two-hybrid DNAs and the pACT cDNA expression library, and D. Rio, L. Mirels, and R. Tjian for helpful comments. Supported by NIH grant GM46638. Y.N. is supported by a postdoctoral fellowship from the Uehara Memorial Foundation
    • We thank D. Rio for help with PCR amplification, L. Pick for the yeast two-hybrid DNAs and the pACT cDNA expression library, and D. Rio, L. Mirels, and R. Tjian for helpful comments. Supported by NIH grant GM46638. Y.N. is supported by a postdoctoral fellowship from the Uehara Memorial Foundation.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.