메뉴 건너뛰기




Volumn 277, Issue 5330, 1997, Pages 1313-1316

Accelerated aging and nucleolar fragmentation in yeast SGS1 mutants

Author keywords

[No Author keywords available]

Indexed keywords

HELICASE;

EID: 0030820491     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.277.5330.1313     Document Type: Article
Times cited : (353)

References (39)
  • 1
    • 0028785586 scopus 로고
    • N. A. Ellis et al., Cell 83, 655 (1995).
    • (1995) Cell , vol.83 , pp. 655
    • Ellis, N.A.1
  • 3
    • 0028061993 scopus 로고
    • K. L. Puranam and P. J. Blackshear, J. Biol. Chem. 269, 29838 (1994); M. Seki et al., Nucleic Acids Res. 22, 4566 (1994).
    • (1994) Nucleic Acids Res. , vol.22 , pp. 4566
    • Seki, M.1
  • 4
    • 15844409553 scopus 로고    scopus 로고
    • C.-E. Yu et al. Science 272, 258 (1996).
    • (1996) Science , vol.272 , pp. 258
    • Yu, C.-E.1
  • 6
    • 0022330944 scopus 로고
    • D. Salk, K. Au, H. Hoehn, M. R. Stenchever, G. M. Martin, Cytogenet. Cell Genet. 30, 108 (1981); G. M. Martin, Adv. Exp. Med. Biol. 190, 161 (1985).
    • (1985) Adv. Exp. Med. Biol. , vol.190 , pp. 161
    • Martin, G.M.1
  • 14
    • 0019364691 scopus 로고
    • A. J. Klar, J. N. Strathern, J. R. Broach, J. B. Hicks, Nature 289, 239 (1981); J. M. Ivy, A. J. S. Klar, J. B. Hicks, Mol. Cell. Biol. 6, 688 (1986); J. Rine and I. Herskowitz, Genetics 116, 9 (1987).
    • (1981) Nature , vol.289 , pp. 239
    • Klar, A.J.1    Strathern, J.N.2    Broach, J.R.3    Hicks, J.B.4
  • 15
    • 0022625954 scopus 로고
    • A. J. Klar, J. N. Strathern, J. R. Broach, J. B. Hicks, Nature 289, 239 (1981); J. M. Ivy, A. J. S. Klar, J. B. Hicks, Mol. Cell. Biol. 6, 688 (1986); J. Rine and I. Herskowitz, Genetics 116, 9 (1987).
    • (1986) Mol. Cell. Biol. , vol.6 , pp. 688
    • Ivy, J.M.1    Klar, A.J.S.2    Hicks, J.B.3
  • 16
    • 0023340731 scopus 로고
    • A. J. Klar, J. N. Strathern, J. R. Broach, J. B. Hicks, Nature 289, 239 (1981); J. M. Ivy, A. J. S. Klar, J. B. Hicks, Mol. Cell. Biol. 6, 688 (1986); J. Rine and I. Herskowitz, Genetics 116, 9 (1987).
    • (1987) Genetics , vol.116 , pp. 9
    • Rine, J.1    Herskowitz, I.2
  • 19
    • 0031044789 scopus 로고    scopus 로고
    • M. Bryk et al., Genes Dev. 11, 255 (1997); J. S. Smith and J. D. Boeke, ibid., p. 241.
    • (1997) Genes Dev. , vol.11 , pp. 255
    • Bryk, M.1
  • 22
    • 0030916153 scopus 로고    scopus 로고
    • B. K. Kennedy et al., ibid. 89, 381 (1997).
    • (1997) Cell , vol.89 , pp. 381
    • Kennedy, B.K.1
  • 24
    • 0030978951 scopus 로고    scopus 로고
    • M. Gotta et al., EMBO J. 16, 3243 (1997).
    • (1997) EMBO J. , vol.16 , pp. 3243
    • Gotta, M.1
  • 29
    • 0027423154 scopus 로고
    • F. Palladino et al., Cell 75, 543 (1993).
    • (1993) Cell , vol.75 , pp. 543
    • Palladino, F.1
  • 30
    • 0023024608 scopus 로고    scopus 로고
    • B. Strehler, Exp. Gerontol. 21, 283 (1986); J. Halle, S. Müller, A. Simm, G. Adam, Eur. J. Cell. Biol., in press.
    • (1986) Exp. Gerontol. , vol.21 , pp. 283
    • Strehler, B.1
  • 32
    • 0017651121 scopus 로고
    • F. B. Adamstone and A. B. Taylor, J. Morphol. 154, 459 (1979); F. Puvion-Dutilleul and A. Macieira-Coelho, Exp. Cell Res. 138, 423 (1983); M. E. Weintein and A. B. Mukherjee, Mech. Ageing. Dev. 42, 215 (1988).
    • (1979) J. Morphol. , vol.154 , pp. 459
    • Adamstone, F.B.1    Taylor, A.B.2
  • 33
    • 0020323583 scopus 로고
    • F. B. Adamstone and A. B. Taylor, J. Morphol. 154, 459 (1979); F. Puvion-Dutilleul and A. Macieira-Coelho, Exp. Cell Res. 138, 423 (1983); M. E. Weintein and A. B. Mukherjee, Mech. Ageing. Dev. 42, 215 (1988).
    • (1983) Exp. Cell Res. , vol.138 , pp. 423
    • Puvion-Dutilleul, F.1    Macieira-Coelho, A.2
  • 34
    • 0023853825 scopus 로고
    • F. B. Adamstone and A. B. Taylor, J. Morphol. 154, 459 (1979); F. Puvion-Dutilleul and A. Macieira-Coelho, Exp. Cell Res. 138, 423 (1983); M. E. Weintein and A. B. Mukherjee, Mech. Ageing. Dev. 42, 215 (1988).
    • (1988) Mech. Ageing. Dev. , vol.42 , pp. 215
    • Weintein, M.E.1    Mukherjee, A.B.2
  • 37
    • 1842360091 scopus 로고    scopus 로고
    • note
    • The region encoding the COOH-terminus of Sgs1 was amplified by the polymerase chain reaction (PCR) (from +3208 to +4344) with oligonucleotides GGGGGGGATCCAATTGTAGAAATAGCGCCAACG and GGGGGGAGCTCTCACTTTCTTCCTCTGTAGTGA. The product ligated to pET-28a(+) (Novagen) between Bam HI and Sac I to create pET28N-SGS1. BL21(DE3) cells (26) were transformed with pET28N-SGS1 and grown in 2 liters of complete medium to an absorbance at 600 nm of 1. Expression was induced with 1 mM isopropyl-β-D-thiogalactopyranoside for 4 hours. Sgs1p was purified with Ni-nitrilotriacetic acid (NTA) agarose under standard conditions.
  • 38
    • 1842313798 scopus 로고    scopus 로고
    • note
    • SGS1 was amplified by the PCR with oligonucleotides GGGGGGGATCCAGTGACGAAGCCGTCACATAACTTA and GGGGGGCGGCCGCTTATCACTTTCTTCCTCTGTAGTGACC for insertion downstream of the galactose-inducible promoter of yCPIF15 (27). Overexpression of GALp-SGS1 was induced by growing for 4 hours in YPGal (10 g/liter yeast extract, 20 g/liter bactopeptone, 2 g/liter galactose), and confirmed by protein immunoblot analysis.
  • 39
    • 1842351248 scopus 로고    scopus 로고
    • note
    • We thank S. Gasser and E. Hurt for antibodies to Sir3p and Nop1p; J. Broach (pDM42), J. Haber (pCW9-1), B. Johnson, D. McNabb, J. Horiuchi, and S. Mah for plasmids and advice; Y.-H. Tu for CELLScan imaging assistance (NIH S10RR917-01); and the Kaiser lab for their Axioscope. Supported by the Helen Hay Whitney Foundation (D.A.S.) and by a National Institutes of Health predoctoral training grant (K.M.). The Guarente lab is supported by a National Institutes of Health grant (AG11119).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.