The POU factor Oct-6 and Schwann cell differentiation

Science

Volumn 273, Issue 5274, 1996, Pages 507-510

  Jaegle, Martine ^a   Mandemakers, Wim ^a   Broos, Ludo ^a   Zwart, Ronald ^a   Karis, Alar ^a   Visser, Pim ^a   Grosveld, Frank ^a   Meijer, Dies ^a  

^a ERASMUS MEDICAL CENTER   (Netherlands)

Author keywords

[No Author keywords available]

Indexed keywords

MESSENGER RNA; MYELIN ASSOCIATED GLYCOPROTEIN; MYELIN BASIC PROTEIN; MYELIN PROTEIN; TRANSCRIPTION FACTOR;

ANIMAL CELL; ANIMAL TISSUE; ARTICLE; GENE MUTATION; GENETIC RECOMBINATION; IMMUNOHISTOCHEMISTRY; MICROSCOPY; MOUSE; MYELINATION; NERVE CELL DIFFERENTIATION; NONHUMAN; POSTNATAL DEVELOPMENT; PRIORITY JOURNAL; PROTEIN EXPRESSION; SCHWANN CELL; SCIATIC NERVE; TRANSCRIPTION REGULATION; ULTRASTRUCTURE;

EID: 0029795302     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.273.5274.507     Document Type: Article

References (23)

1. K. R. Jessen et al., Neuron 12, 509 (1994); K. R. Jessen and R. Mirsky, Curr. Opin. Neurobiol. 2, 575 (1992); N. M. LeDouarin, C. Ziller, G. F. Couly, Dev. Biol. 159, 24 (1993); H. J. Weinberg and P. S. Spencer, J. Neurocytol. 4, 395 (1975).
2. K. R. Jessen et al., Neuron 12, 509 (1994); K. R. Jessen and R. Mirsky, Curr. Opin. Neurobiol. 2, 575 (1992); N. M. LeDouarin, C. Ziller, G. F. Couly, Dev. Biol. 159, 24 (1993); H. J. Weinberg and P. S. Spencer, J. Neurocytol. 4, 395 (1975).
3. K. R. Jessen et al., Neuron 12, 509 (1994); K. R. Jessen and R. Mirsky, Curr. Opin. Neurobiol. 2, 575 (1992); N. M. LeDouarin, C. Ziller, G. F. Couly, Dev. Biol. 159, 24 (1993); H. J. Weinberg and P. S. Spencer, J. Neurocytol. 4, 395 (1975).
4. K. R. Jessen et al., Neuron 12, 509 (1994); K. R. Jessen and R. Mirsky, Curr. Opin. Neurobiol. 2, 575 (1992); N. M. LeDouarin, C. Ziller, G. F. Couly, Dev. Biol. 159, 24 (1993); H. J. Weinberg and P. S. Spencer, J. Neurocytol. 4, 395 (1975).
5. G. Lemke, in Molecular Neurobiology, Z. W. Hall, Ed. (Sinauer, Sunderland, MA, 1992), p. 281; C. Kioussi, M. K. Gross, P. Gruss, Neuron 15, 553 (1995); P. Topilko et al., Nature 371, 796 (1994); E. S. Monuki, R. Kuhn, G. Weinmaster, B. D. Trapp, G. Lemke, Science 249, 1300 (1990).
6. G. Lemke, in Molecular Neurobiology, Z. W. Hall, Ed. (Sinauer, Sunderland, MA, 1992), p. 281; C. Kioussi, M. K. Gross, P. Gruss, Neuron 15, 553 (1995); P. Topilko et al., Nature 371, 796 (1994); E. S. Monuki, R. Kuhn, G. Weinmaster, B. D. Trapp, G. Lemke, Science 249, 1300 (1990).
7. G. Lemke, in Molecular Neurobiology, Z. W. Hall, Ed. (Sinauer, Sunderland, MA, 1992), p. 281; C. Kioussi, M. K. Gross, P. Gruss, Neuron 15, 553 (1995); P. Topilko et al., Nature 371, 796 (1994); E. S. Monuki, R. Kuhn, G. Weinmaster, B. D. Trapp, G. Lemke, Science 249, 1300 (1990).
8. G. Lemke, in Molecular Neurobiology, Z. W. Hall, Ed. (Sinauer, Sunderland, MA, 1992), p. 281; C. Kioussi, M. K. Gross, P. Gruss, Neuron 15, 553 (1995); P. Topilko et al., Nature 371, 796 (1994); E. S. Monuki, R. Kuhn, G. Weinmaster, B. D. Trapp, G. Lemke, Science 249, 1300 (1990).
9. E. S. Monuki, G. Weinmaster, R. Kuhn, G. Lemke, Neuron 3, 783 (1989); X. He et al., Nature 340, 35 (1989); N. Suzuki et al., EMBO J. 9, 3723 (1990); D. Meijer et al., Nucleic Acids Res. 18, 7357 (1990).
10. E. S. Monuki, G. Weinmaster, R. Kuhn, G. Lemke, Neuron 3, 783 (1989); X. He et al., Nature 340, 35 (1989); N. Suzuki et al., EMBO J. 9, 3723 (1990); D. Meijer et al., Nucleic Acids Res. 18, 7357 (1990).
11. E. S. Monuki, G. Weinmaster, R. Kuhn, G. Lemke, Neuron 3, 783 (1989); X. He et al., Nature 340, 35 (1989); N. Suzuki et al., EMBO J. 9, 3723 (1990); D. Meijer et al., Nucleic Acids Res. 18, 7357 (1990).
12. E. S. Monuki, G. Weinmaster, R. Kuhn, G. Lemke, Neuron 3, 783 (1989); X. He et al., Nature 340, 35 (1989); N. Suzuki et al., EMBO J. 9, 3723 (1990); D. Meijer et al., Nucleic Acids Res. 18, 7357 (1990).
13. R. Zwart, thesis, Erasmus University, Rotterdam (1996).
14. S. S. Scherer et al., J. Neurosci. 14, 1930 (1994).
15. E. S. Monuki, R. Kuhn, G. Lemke, Mech. Dev. 42, 15 (1993); D. E. Weinstein, P. G. Burrola, G. Lemke, Mol. Cell. Neurosci. 6, 212 (1995); X. He et al., Mol. Cell. Biol. 11, 1739 (1991).
16. E. S. Monuki, R. Kuhn, G. Lemke, Mech. Dev. 42, 15 (1993); D. E. Weinstein, P. G. Burrola, G. Lemke, Mol. Cell. Neurosci. 6, 212 (1995); X. He et al., Mol. Cell. Biol. 11, 1739 (1991).
17. E. S. Monuki, R. Kuhn, G. Lemke, Mech. Dev. 42, 15 (1993); D. E. Weinstein, P. G. Burrola, G. Lemke, Mol. Cell. Neurosci. 6, 212 (1995); X. He et al., Mol. Cell. Biol. 11, 1739 (1991).
18. 2 generation.
19. R. Zwart, L. Broos, G. Grosveld, D. Meijer, Mech. Dev. 54, 185 (1996).
20. o monoclonal antibody P07 was provided by J. J. Archelos [J. J. Archelos et al., J. Neurosci Res. 35, 46 (1993)]. Other monoclonal antibodies were obtained from Boehringer Mannheim (MBP), Sigma (CNP), and Amersham (NF 160). For RT-PCR, RNA was extracted with the LiCl-urea method and reverse-transcribed into cDNA with oligo(dT) and hexamer primers. Excess primers were removed on a Centricon C-30 (Amicon) concentrator. For MBP amplification, we used cDNA generated from P8 sciatic nerve RNA. After 20-fold dilution, polymerase chain reaction (PCR) amplification was performed by use of the Expand long template PCR system (Boehringer Mannheim). Each amplification cycle comprised 30 s at 94°C, 1 min at 55°C, and 1 min at 68°C. After the 10th amplification cycle, the extension time was increased with 20-s increments. Samples were taken at cycles 20, 22, 24, and 26. The following primers were used: MAG: 5′-primer GCCACGGTCATCTATGAGAGTCAGC and 3′-primer GGTGCCCAGAGATTCTGAATTCGG; HPRT: 5′-primer CACAGGACTAGAACACCTGC and 3′-primer GCTGGTGAAAAGGACCTCT; PMP-22: 5′-primer ACACTGCTACTCCTCATCAGTGAG and 3′-primer CAGGATCACATAGATGATACCACTG; and MBP: 5′-primer ACTCACACACGAGAACTACCCA and 3′-primer CCAGCTAAATCTGCTGAGGG. The amplified fragments yielded bands of 605 bp for MAG, 316 bp for PMP-22, 249 bp for HPRT, and 170 bp for MBP, Amplification products were separated on a 4% denaturing polyacrylamide gel, and signals were measured with a Molecular Dynamics phosphoimager.
21. Animals were perfused with phosphate-buffered saline, pH 7,2, for 3 min followed by fixative (3% paraformaldehyde and 1% glutaraldehyde buffered by 100 mM cacodylate at pH 7.2) for 10 min. Nerves were dissected, cut into smaller pieces, and fixed overnight in the same fixative. After postfixation in 1% osmium tetroxide, the sample was embedded in Epon. Ultra-thin sections were stained with uranyl acetate and lead citrate. Sections were examined and photographed with a Philips CM100 electron microscope.
22. R. Mirsky and K. R. Jessen, Curr. Opin. Neurobiol. 6, 89 (1996).
23. o antibodies and L. Braam for animal care. All animal experiments were carried out under license 132-95-03 (Institutional Animal Care and Use Committee, Erasmus University).