Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain

Science

Volumn 273, Issue 5276, 1996, Pages 794-797

  Xu, Xiang ^a   Sun, Ya Lin ^a   Hoey, Timothy ^a  

^a AMGEN INC   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

DNA; DNA BINDING PROTEIN; GAMMA INTERFERON; STATIN;

AMINO TERMINAL SEQUENCE; ARTICLE; CONSENSUS SEQUENCE; DNA SEQUENCE; MOLECULAR RECOGNITION; PRIORITY JOURNAL; PROTEIN DNA BINDING; PROTEIN DOMAIN; PROTEIN FAMILY; SIGNAL TRANSDUCTION; TRANSCRIPTION REGULATION;

EID: 0029739627     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.273.5276.794     Document Type: Article

References (37)

1. C. Schindler and J. E. Darnell Jr., Annu. Rev. Biochem. 64, 621 (1995).
2. A. C. Greenlund et al., Immunity 2, 677 (1995); M. H. Heim, I. M. Kerr, G. R. Stark, J. E. Darnell Jr., Science 267, 1347 (1995); J. Hou et al., ibid. 265, 1701 (1994).
3. A. C. Greenlund et al., Immunity 2, 677 (1995); M. H. Heim, I. M. Kerr, G. R. Stark, J. E. Darnell Jr., Science 267, 1347 (1995); J. Hou et al., ibid. 265, 1701 (1994).
4. A. C. Greenlund et al., Immunity 2, 677 (1995); M. H. Heim, I. M. Kerr, G. R. Stark, J. E. Darnell Jr., Science 267, 1347 (1995); J. Hou et al., ibid. 265, 1701 (1994).
5. C. M. Horvath, Z. Wen, J. E. Darnell Jr., Genes Dev. 9, 984 (1995).
6. U. Schindier, P, Wu, M. Rothe, M. Brasseur, S. L. McKnignt Immunity 2, 689 (1995).
7. Z. Wen, Z. Zhong, J. E. Darnell Jr., Cell 82, 24 (1995); P. Mikita and U, Schindler, unpublished results.
8. Z. Wen, Z. Zhong, J. E. Darnell Jr., Cell 82, 24 (1995); P. Mikita and U, Schindler, unpublished results.
9. S. A. Quresni B. Leung, I. M. Kerr, G. R. Stark, J. E. Darnell Jr.. Mol. Cell. Biol. 16, 288 (1996); T. Improta et al., Proc. Natl. Acad. Sci. U.S.A. 91, 4776 (1994).
10. S. A. Quresni B. Leung, I. M. Kerr, G. R. Stark, J. E. Darnell Jr.. Mol. Cell. Biol. 16, 288 (1996); T. Improta et al., Proc. Natl. Acad. Sci. U.S.A. 91, 4776 (1994).
11. G. Trincnieri, Annu. Rev. Immunol. 13, 251 (1995).
12. C. M. Bacen et al., Proc. Natl. Acad. Sci. U.S.A. 92, 7307 (1995); N. G. Jacobson et al., J. Exp. Med. 181, 1755 (1995); T. Hoey, unpublished results.
13. C. M. Bacen et al., Proc. Natl. Acad. Sci. U.S.A. 92, 7307 (1995); N. G. Jacobson et al., J. Exp. Med. 181, 1755 (1995); T. Hoey, unpublished results.
14. C. M. Bacen et al., Proc. Natl. Acad. Sci. U.S.A. 92, 7307 (1995); N. G. Jacobson et al., J. Exp. Med. 181, 1755 (1995); T. Hoey, unpublished results.
15. Degenerate oligonucleotide primers based on the murine sequence [K. Yamamoto et al., Mol. Cell. Biol. 14, 4342 (1994); Z. Zhong, Z. Wen, J. E. Darnell Jr., Proc. Natl. Acad. Sci. U.S.A. 91, 4806 (1994 )] were used to isolate a 280-bp fragment of the human STAT4 cDNA by reverse transcriptase-polymerase chain reaction from Jurkat cell polyadenylated RNA. This fragment, corresponding to the region encoding residues 94 to 187, was used to screen a cDNA library prepared from Jurkat cells [ T. Hoey, Y. Sun, K. Williamson, X. Xu, immunity 2, 461 (1995)]. The Gen-Bank accession number for the cDNA sequence is L78440. The STAT4 coding region was cloned into the baculovirus expression vector pVL 1393 (Invitrogen) with a His tag at the COOH-terminal end. Proteins were purified by Ni-affinity chromatography (Qiagen). STATs 1, 5, and 6 were expressed and purified by identical methods. For DNA binding studies, insect cells were infected with recombinant viruses encoding JAK1 and one of the STATs.
16. Degenerate oligonucleotide primers based on the murine sequence [K. Yamamoto et al., Mol. Cell. Biol. 14, 4342 (1994); Z. Zhong, Z. Wen, J. E. Darnell Jr., Proc. Natl. Acad. Sci. U.S.A. 91, 4806 (1994 )] were used to isolate a 280-bp fragment of the human STAT4 cDNA by reverse transcriptase-polymerase chain reaction from Jurkat cell polyadenylated RNA. This fragment, corresponding to the region encoding residues 94 to 187, was used to screen a cDNA library prepared from Jurkat cells [ T. Hoey, Y. Sun, K. Williamson, X. Xu, immunity 2, 461 (1995)]. The Gen-Bank accession number for the cDNA sequence is L78440. The STAT4 coding region was cloned into the baculovirus expression vector pVL 1393 (Invitrogen) with a His tag at the COOH-terminal end. Proteins were purified by Ni-affinity chromatography (Qiagen). STATs 1, 5, and 6 were expressed and purified by identical methods. For DNA binding studies, insect cells were infected with recombinant viruses encoding JAK1 and one of the STATs.
17. Degenerate oligonucleotide primers based on the murine sequence [K. Yamamoto et al., Mol. Cell. Biol. 14, 4342 (1994); Z. Zhong, Z. Wen, J. E. Darnell Jr., Proc. Natl. Acad. Sci. U.S.A. 91, 4806 (1994 )] were used to isolate a 280-bp fragment of the human STAT4 cDNA by reverse transcriptase-polymerase chain reaction from Jurkat cell polyadenylated RNA. This fragment, corresponding to the region encoding residues 94 to 187, was used to screen a cDNA library prepared from Jurkat cells [ T. Hoey, Y. Sun, K. Williamson, X. Xu, immunity 2, 461 (1995)]. The Gen-Bank accession number for the cDNA sequence is L78440. The STAT4 coding region was cloned into the baculovirus expression vector pVL 1393 (Invitrogen) with a His tag at the COOH-terminal end. Proteins were purified by Ni-affinity chromatography (Qiagen). STATs 1, 5, and 6 were expressed and purified by identical methods. For DNA binding studies, insect cells were infected with recombinant viruses encoding JAK1 and one of the STATs.
18. T. K. Blackwell and H. Weintraub, Science 250, 1104 (1990).
19. The optimal STAT4 binding site was selected from a pool of oligonucleotides with random bases at 14 adjacent positions. The bound sequences were separated from the unbound by gel mobility-shift. After three rounds of selection the bound fragments were cloned, and 18 independent isolates were sequenced. All 18 fragments displayed the same 9-nucleotide consensus binding sequence, TTCCGGGAA.
20. J. N. Ihle, Cell 84, 331 (1996); U. Schindler, unpublished results.
21. J. N. Ihle, Cell 84, 331 (1996); U. Schindler, unpublished results.
22. M. H. Kaplan, Y.-L. Sun, T. Hoey, M. J. Grusby, Nature 382, 162 (1996).
23. P. Gray and D. V. Goeddel, Nature 298, 859 (1982).
24. H. A. Young et al., J. Immunol, 143, 2389 (1989).
25. K. J. Hardy, B. M. Peterlin, R. E. Atchinson, J. D. Stobo, Proc. Natl. Acad. Sci. U.S.A. 82, 8173 (1985); T. Hoey and Y.-L. Sun, unpublished results.
26. K. J. Hardy, B. M. Peterlin, R. E. Atchinson, J. D. Stobo, Proc. Natl. Acad. Sci. U.S.A. 82, 8173 (1985); T. Hoey and Y.-L. Sun, unpublished results.
27. 4, 1 mM NaF, 1 mM β-glycerophosphate, and 1 μg of poly(dl-dC). The amount of STAT proteins in the binding reactions was between 50 and 500 ng. Only a small fraction of the purified STAT proteins was tyrosine phosphorylated and active for DNA binding. A Hind III to Sac I fragment that was labeled at the Hind III site was used for the footprints.
28. 2. The sequences of the oligonucleotides were as follows: the high-affinity single site, TTATGTTTCCGGGAAATGAG; site 2 + 3, CGCGAAAATTTTAAGTGAATTTTTTGAGTTTCT-TTTAAAATTTT: site 2* + 3, CGCGAAAATTgAGT-GgTTTTTTTGAGTTTCTTTTAAAATTTT; and site 2 + 3*, CGCGAAAATTTTAAGTGAATTTTTT-GAGTccCTTTTttAATTTT. The positions of the consensus binding sites are underlined, and the positions of the altered bases are in lowercase letters. The antibodies used in Fig. 4A were obtained from Santa Cruz Biotechnology.
29. S. H. Chan, M. Kobayashi, D. Santoli, B. Perussia, G. Trinchieri, J. Immunol. 148, 92 (1992); K. J. Hardy and T. Sawada, J. Exp. Med. 170, 1021 (1989); C.-S. Hsieh et al., Science 260, 547 (1993).
30. S. H. Chan, M. Kobayashi, D. Santoli, B. Perussia, G. Trinchieri, J. Immunol. 148, 92 (1992); K. J. Hardy and T. Sawada, J. Exp. Med. 170, 1021 (1989); C.-S. Hsieh et al., Science 260, 547 (1993).
31. S. H. Chan, M. Kobayashi, D. Santoli, B. Perussia, G. Trinchieri, J. Immunol. 148, 92 (1992); K. J. Hardy and T. Sawada, J. Exp. Med. 170, 1021 (1989); C.-S. Hsieh et al., Science 260, 547 (1993).
32. 2-terminal deletion mutant were cloned into the cytomegalovirus vector pRK-5, JAK1 was expressed from the plasmid pSRa. Luclferase reporter plasmids contained either two copies of the site 2 + 3 oligonucleotide or two copies of a high-affinity STAT site upstream of the herpes simplex virus thymidine kinase basal promoter (-50 to +10) in pGL2-basic. The high-affinity STAT site was derived from the IRF-1 promoter, GCCGTCATTTCGGGGAAATCA [S. H. Sims, Y. Cha, M. F. Romine, P. E. Gao, K. Gottleib, A. B. Deisseroth, Mol. Cell. Biol. 13, 690 (1993)]. Each transfection contained 1.5 μg of the STAT4 and luciferase plasmids and 1 μg of Rous sarcoma virus β-galactosidase. The transfections with the IFN-γ sites also included 0.5 μg of the JAK1 expression vector. Transfection efficiencies were standardized by measurement of β-galactosidase activity.
33. X. Xu, Y.-L. Sun, T. Hoey, unpublished results.
34. The sequence within the region protected by STAT1 and STAT4 is AGTCCTTGAATGGTGTGAAGTAAAA-GTGCCTT*CAAAG*AATCCCC. The positions with the best match to the consensus binding site are underlined. Two nucleotides in the downstream site indicated by the asterisks were changed in the mutant fragment. The T was deleted and the G was changed to C.
35. Multiple STAT binding sites were detected by DNase I footprint analysis within a Kpn I to Ace I fragment from the downstream intron. Among these sites was a pair of sites that was specifically recognized by STAT1. The sequence with the protected region was ACCTTCTTTGCTCCAAAACTCTACAATGCAAAG*-AATAGA, which corresponds to the sequence for the gel shift in Fig. 3C. A single point mutation was made by changing the G (indicated by the asterisk) to C.
36. A portion of the STAT4 cDNA encoding amino acids 1 to 124 with a His tag at the COOH-terminal end was subcloned into the T7 promoter expression vector pET-3A. Protein was expressed in the strain BL21(DE3) and purified by Ni-affinity chromatography.
37. We acknowledge K. Williamson for DNA sequencing and M. Rothe for help with cloning human STAT4. We thank U. Schindler, M. Rothe, T. Mikita, and S. McKnight for comments on the manuscript and helpful discussions, and Genetics Institute for IL-12. B. Schreiber and D. Goeddel provided valuable advice and reagents.