메뉴 건너뛰기




Volumn 87, Issue 8, 2005, Pages 781-790

Stabilization of purine motif DNA triplex by a tetrapeptide from the binding domain of HMGBI protein

Author keywords

DNA triplex; HMGB1; Peptide; Triplex stabilization; Tryptophan intercalation

Indexed keywords

DNA; HIGH MOBILITY GROUP B1 PROTEIN; PROLYLLYSYLARGINYLTRYPTOPHAN; PURINE; TETRAPEPTIDE; TRYPTOPHAN; UNCLASSIFIED DRUG;

EID: 23044462174     PISSN: 03009084     EISSN: None     Source Type: Journal    
DOI: 10.1016/j.biochi.2005.01.016     Document Type: Article
Times cited : (20)

References (37)
  • 1
    • 33947470407 scopus 로고
    • Formation of a three-stranded polynucleotides molecule
    • G. Felsenfeld, D.R. Davis, and A. Rich Formation of a three-stranded polynucleotides molecule J. Am. Chem. Soc. 79 1957 2023 2024
    • (1957) J. Am. Chem. Soc. , vol.79 , pp. 2023-2024
    • Felsenfeld, G.1    Davis, D.R.2    Rich, A.3
  • 3
    • 0025270759 scopus 로고
    • Sequence specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides
    • L. Perrouault, U. Aseline, C. Rivalle, N.T. Thuong, E. Bisagni, and C. Giovannangeli Sequence specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides Nature 344 1990 358 360
    • (1990) Nature , vol.344 , pp. 358-360
    • Perrouault, L.1    Aseline, U.2    Rivalle, C.3    Thuong, N.T.4    Bisagni, E.5    Giovannangeli, C.6
  • 4
    • 0025953701 scopus 로고
    • Sequence specific photo-induced cross-linking of the two strands of double-helical DNA by a psoralen covalently linked to a triple helix-forming oligonucleotide
    • M. Takasugi, A. Guendouz, and M. Chassignol Sequence specific photo-induced cross-linking of the two strands of double-helical DNA by a psoralen covalently linked to a triple helix-forming oligonucleotide Proc. Natl. Acad. Sci. USA 88 1992 5602 5608
    • (1992) Proc. Natl. Acad. Sci. USA , vol.88 , pp. 5602-5608
    • Takasugi, M.1    Guendouz, A.2    Chassignol, M.3
  • 5
    • 0026739476 scopus 로고
    • Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine and guanine
    • C. Giovannangeli, M. Rougee, T. Garestier, N.T. Thuong, and C. Helene Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine and guanine Proc. Natl. Acad. Sci. USA 89 1992 8631 8635
    • (1992) Proc. Natl. Acad. Sci. USA , vol.89 , pp. 8631-8635
    • Giovannangeli, C.1    Rougee, M.2    Garestier, T.3    Thuong, N.T.4    Helene, C.5
  • 6
    • 0024341224 scopus 로고
    • Sequence specific intercalating agents: Intercalation at specific sequences on duplex dna via major groove recognition by oligonucleotide- intercalator conjugates
    • J.S. Sun, J.C. Francois, T. Garestier, T. Saison, V. Roig, N.T. Thuong, and C. Helene Sequence specific intercalating agents: intercalation at specific sequences on duplex dna via major groove recognition by oligonucleotide- intercalator conjugates Proc. Natl. Acad. Sci. USA 86 1989 9198 9202
    • (1989) Proc. Natl. Acad. Sci. USA , vol.86 , pp. 9198-9202
    • Sun, J.S.1    Francois, J.C.2    Garestier, T.3    Saison, T.4    Roig, V.5    Thuong, N.T.6    Helene, C.7
  • 8
    • 0027183252 scopus 로고
    • Characterization of a triple helix-specific ligand. BePI (3-methoxy-7H-8-methyl-11-[(3′-amino)propylamino]-benzo[e]pyrido[4,3-b] indole) intercalates into both double-helical and triple-helical DNA
    • D.S. Pilch, M.J. Waring, J.S. Sun, M. Rougee, C.H. Nguyen, E. Bisagni, T. Garestier, and C. Helene Characterization of a triple helix-specific ligand. BePI (3-methoxy-7H-8-methyl-11-[(3′-amino)propylamino]-benzo[e]pyrido[4,3- b]indole) intercalates into both double-helical and triple-helical DNA J. Mol. Biol. 232 1993 926 946
    • (1993) J. Mol. Biol. , vol.232 , pp. 926-946
    • Pilch, D.S.1    Waring, M.J.2    Sun, J.S.3    Rougee, M.4    Nguyen, C.H.5    Bisagni, E.6    Garestier, T.7    Helene, C.8
  • 9
    • 0028869131 scopus 로고
    • Stabilization of triple helical nucleic acids by basic oligopeptides
    • V.N. Potaman, and R.R. Sinden Stabilization of triple helical nucleic acids by basic oligopeptides Biochemistry 34 1995 14885 14892
    • (1995) Biochemistry , vol.34 , pp. 14885-14892
    • Potaman, V.N.1    Sinden, R.R.2
  • 10
    • 0032530650 scopus 로고    scopus 로고
    • Stabilization of intermolecular triple/single-strand structure by cationic peptides
    • V.N. Potaman, and R.R. Sinden Stabilization of intermolecular triple/single-strand structure by cationic peptides Biochemistry 37 1998 12952 12961
    • (1998) Biochemistry , vol.37 , pp. 12952-12961
    • Potaman, V.N.1    Sinden, R.R.2
  • 11
    • 0034839608 scopus 로고    scopus 로고
    • Amphiphilic beta sheet peptides can bind to double and triple stranded DNA
    • K. Yokoyama, T. Kubo, and M. Fujii Amphiphilic beta sheet peptides can bind to double and triple stranded DNA Nucleosides Nucleotides Nucleic Acids 20 2001 1317 1320
    • (2001) Nucleosides Nucleotides Nucleic Acids , vol.20 , pp. 1317-1320
    • Yokoyama, K.1    Kubo, T.2    Fujii, M.3
  • 12
    • 0030725454 scopus 로고    scopus 로고
    • Trinucleotide repeats affect DNA replication in vivo
    • G.M. Samadashwily, G. Raca, and S.M. Mirkin Trinucleotide repeats affect DNA replication in vivo Nat. Genet. 17 1997 298 304
    • (1997) Nat. Genet. , vol.17 , pp. 298-304
    • Samadashwily, G.M.1    Raca, G.2    Mirkin, S.M.3
  • 13
    • 0029873571 scopus 로고    scopus 로고
    • Trinucleotide instability: A repeating theme in human inherited disorders
    • J.F. Gusella, and M.E. Mac Donald Trinucleotide instability: a repeating theme in human inherited disorders Annu. Rev. Med. 47 1996 201 209
    • (1996) Annu. Rev. Med. , vol.47 , pp. 201-209
    • Gusella, J.F.1    Mac Donald, M.E.2
  • 14
    • 0036127084 scopus 로고    scopus 로고
    • Formation and Thermodynamic stability of Intermolecular (R*R·Y) DNA triplex in GAA/TTC Repeats Associated with Friedreich's Ataxia
    • A. Jain, M.R. Rajeswari, and F. Ahmed Formation and Thermodynamic stability of Intermolecular (R*R·Y) DNA triplex In GAA/TTC Repeats Associated with Friedreich's Ataxia J. Biomol. Struct. Dyn. 19 2002 691 699
    • (2002) J. Biomol. Struct. Dyn. , vol.19 , pp. 691-699
    • Jain, A.1    Rajeswari, M.R.2    Ahmed, F.3
  • 15
    • 0028359704 scopus 로고
    • DNA looping by the HMG-box domains of HMG1 and modulation of DNA binding by the acidic C-terminal domain
    • M. Stros, J. Strokrova, and J.O. Thomas DNA looping by the HMG-box domains of HMG1 and modulation of DNA binding by the acidic C-terminal domain Nucleic Acids Res. 22 1994 1041 1044
    • (1994) Nucleic Acids Res. , vol.22 , pp. 1041-1044
    • Stros, M.1    Strokrova, J.2    Thomas, J.O.3
  • 17
    • 0029848281 scopus 로고    scopus 로고
    • A novel activity of HMG domains: Promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides
    • T. Suda, Y. Mishima, K. Takayanagi, H. Asakura, S. Odani, and R. Kominami A novel activity of HMG domains: promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides Nucleic Acids Res. 24 1996 4733 4740
    • (1996) Nucleic Acids Res. , vol.24 , pp. 4733-4740
    • Suda, T.1    Mishima, Y.2    Takayanagi, K.3    Asakura, H.4    Odani, S.5    Kominami, R.6
  • 18
    • 0014725117 scopus 로고
    • Oligonucleotide interactions: Circular dichroism studies of the conformations of deoxy-oligonucleotides
    • C.R. Cantor, M.M. Warshaw, and H. Shapiro Oligonucleotide interactions: circular dichroism studies of the conformations of deoxy-oligonucleotides Biopolymers 9 1970 1059 1077
    • (1970) Biopolymers , vol.9 , pp. 1059-1077
    • Cantor, C.R.1    Warshaw, M.M.2    Shapiro, H.3
  • 19
    • 0023661021 scopus 로고
    • Does tryptophan intercalate in DNA? a comparative study of peptide binding to alternating and nonalternating A.T sequences
    • M.R. Rajeswari, T. Garestier, and C. Helene Does tryptophan intercalate in DNA? A comparative study of peptide binding to alternating and nonalternating A.T sequences Biochemistry 26 1987 6825 6831
    • (1987) Biochemistry , vol.26 , pp. 6825-6831
    • Rajeswari, M.R.1    Garestier, T.2    Helene, C.3
  • 20
    • 0023406843 scopus 로고
    • Calculating Thermodynamic data for transitions of and molecularity from equilibrium melting curves
    • L.A. Marky, and K.J. Breslauer Calculating Thermodynamic data for transitions of and molecularity from equilibrium melting curves Biopolymers 26 1987 1601 1620
    • (1987) Biopolymers , vol.26 , pp. 1601-1620
    • Marky, L.A.1    Breslauer, K.J.2
  • 21
    • 0029090754 scopus 로고
    • Characterization of the DNA triplex formed by d (TGGGTCCCTGCGGTTGGGTGGG) and critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene
    • L.E. Xodo Characterization of the DNA triplex formed by d (TGGGTCCCTGCGGTTGGGTGGG) and critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene FEBS Lett. 370 1995 153 157
    • (1995) FEBS Lett. , vol.370 , pp. 153-157
    • Xodo, L.E.1
  • 22
    • 0026748690 scopus 로고
    • Binding of oligopeptides d-AGATCTAGATCT and d-AAGCTTAAGCTT: Can tryptophan intercalate in DNA hairpins?
    • M.R. Rajeswari, H.S. Bose, S. Kukreti, A. Gupta, V.S. Chauhan, and K.B. Roy Binding of oligopeptides d-AGATCTAGATCT and d-AAGCTTAAGCTT: can tryptophan intercalate in DNA hairpins? Biochemistry 31 1992 6237 6241
    • (1992) Biochemistry , vol.31 , pp. 6237-6241
    • Rajeswari, M.R.1    Bose, H.S.2    Kukreti, S.3    Gupta, A.4    Chauhan, V.S.5    Roy, K.B.6
  • 23
    • 0029811874 scopus 로고    scopus 로고
    • Tryptophan intercalation in G, C containing polynucleotides Z to B conversion of poly [d(G-5MC)] in low salt induced by a tetrapeptide
    • M.R. Rajeswari Tryptophan intercalation in G, C containing polynucleotides Z to B conversion of poly [d(G-5MC)] in low salt induced by a tetrapeptide J. Biomol. Struct. Dyn. 14 1996 25 30
    • (1996) J. Biomol. Struct. Dyn. , vol.14 , pp. 25-30
    • Rajeswari, M.R.1
  • 24
    • 0036804485 scopus 로고    scopus 로고
    • Preferential binding of quinolones to DNA with alternating G, C/A, T sequences: A spectroscopic study
    • A. Jain, and M.R. Rajeswari Preferential binding of quinolones to DNA with alternating G, C/A, T sequences: a spectroscopic study J. Biomol. Struct. Dyn. 20 2002 291 299
    • (2002) J. Biomol. Struct. Dyn. , vol.20 , pp. 291-299
    • Jain, A.1    Rajeswari, M.R.2
  • 25
    • 0037767737 scopus 로고    scopus 로고
    • A. Jain, M.R. Rajeswari, Binding studies on peptide-oligonucleotide complex: Intercalation of tryptophan in GC-rich region of c-myc gene
    • S. Akanchha A. Jain, M.R. Rajeswari, Binding studies on peptide-oligonucleotide complex: intercalation of tryptophan in GC-rich region of c-myc gene Biochim. Biophys. Acta 1622 2003 73 81
    • (2003) Biochim. Biophys. Acta , vol.1622 , pp. 73-81
    • Akanchha, S.1
  • 26
    • 0017116135 scopus 로고
    • Theoretical calculations of the helix-coil transition of DNA in the presence of large, cooperatively binding ligands
    • J.D. McGhee Theoretical calculations of the helix-coil transition of DNA in the presence of large, cooperatively binding ligands Biopolymers 15 1976 1345 1375
    • (1976) Biopolymers , vol.15 , pp. 1345-1375
    • McGhee, J.D.1
  • 27
    • 0033291983 scopus 로고    scopus 로고
    • Interaction of amphiphilic cyclic peptide with double and triple stranded DNA
    • K. Yokoyama, T. Kubo, and M. Fujii Interaction of amphiphilic cyclic peptide with double and triple stranded DNA Nucleic Acids Symp. Ser. 42 1999 169 170
    • (1999) Nucleic Acids Symp. Ser. , vol.42 , pp. 169-170
    • Yokoyama, K.1    Kubo, T.2    Fujii, M.3
  • 28
    • 0020012345 scopus 로고
    • Interactions between functional groups in protein-nucleic acid associations
    • C. Helene, and G. Lancelot Interactions between functional groups in protein-nucleic acid associations Prog. Biophys. Mol. Biol. 39 1982 1 68
    • (1982) Prog. Biophys. Mol. Biol. , vol.39 , pp. 1-68
    • Helene, C.1    Lancelot, G.2
  • 29
    • 0031553987 scopus 로고    scopus 로고
    • Studies on formation and stability of the d[G(AG)5]* d[G(AG)5]. d[C(TC)5] and d[G(TG)5]*d[G(AG)5]. d[C(TC)5] triple helices
    • Y. He, P.V. Scaria, and R.H. Shafer Studies on formation and stability of the d[G(AG)5]* d[G(AG)5]. d[C(TC)5] and d[G(TG)5]*d[G(AG)5]. d[C(TC)5] triple helices Biopolymers 41 1997 431 441
    • (1997) Biopolymers , vol.41 , pp. 431-441
    • He, Y.1    Scaria, P.V.2    Shafer, R.H.3
  • 30
    • 0029658622 scopus 로고    scopus 로고
    • Single stand targeted triplex formation: Physicochemical and biochemical properties of fold back triplexes
    • E.R. Kandimalla, A. Manning, and S. Aggrawal Single stand targeted triplex formation: physicochemical and biochemical properties of fold back triplexes J. Biomol. Struct. Dyn. 14 1996 79 90
    • (1996) J. Biomol. Struct. Dyn. , vol.14 , pp. 79-90
    • Kandimalla, E.R.1    Manning, A.2    Aggrawal, S.3
  • 31
    • 0003940109 scopus 로고
    • V. Hruby Academic Press New York
    • R.W. Woody V. Hruby 'The peptides' 1985 Academic Press New York vol. 7, Chapter 2
    • (1985) 'The Peptides'
    • Woody, R.W.1
  • 32
    • 0015912223 scopus 로고
    • Far-ultraviolet absorption and circular dichroism spectra of l-tryptophan and some derivatives
    • H.E. Auer Far-ultraviolet absorption and circular dichroism spectra of l-tryptophan and some derivatives J. Am. Chem. Soc. 95 1973 3003 3011
    • (1973) J. Am. Chem. Soc. , vol.95 , pp. 3003-3011
    • Auer, H.E.1
  • 33
    • 0016663420 scopus 로고
    • Interaction of aromatic residues of proteins with nucleic acids. Circular dichroism studies of the binding of oligopeptides to poly (adenylic acid)
    • F. Brun, J.J. Toulme, and C. Helene Interaction of aromatic residues of proteins with nucleic acids. Circular dichroism studies of the binding of oligopeptides to poly (adenylic acid) Biochemistry 14 1975 558 563
    • (1975) Biochemistry , vol.14 , pp. 558-563
    • Brun, F.1    Toulme, J.J.2    Helene, C.3
  • 34
    • 0015231794 scopus 로고
    • Reflectance and luminescence studies of molecular complex formation between tryptophan and nucleic acid components in frozen aqueous solutions
    • T. Gerestier, and C. Helene Reflectance and luminescence studies of molecular complex formation between tryptophan and nucleic acid components in frozen aqueous solutions Biochemistry 10 1971 300 306
    • (1971) Biochemistry , vol.10 , pp. 300-306
    • Gerestier, T.1    Helene, C.2
  • 35
    • 0019399694 scopus 로고
    • Interactions of oligopeptides with nucleic acids
    • C. Helene, and J.C. Maurizot Interactions of oligopeptides with nucleic acids CRC Crit. Rev. Biochem. 10 1981 213 258
    • (1981) CRC Crit. Rev. Biochem. , vol.10 , pp. 213-258
    • Helene, C.1    Maurizot, J.C.2
  • 36
    • 0017600319 scopus 로고
    • Specific recognition of single-stranded nucleic acids interaction of tryptophan-containing peptides with native, denatured and ultraviolet-irradiated DNA
    • J.J. Toulme, and C. Helene Specific recognition of single-stranded nucleic acids interaction of tryptophan-containing peptides with native, denatured and ultraviolet-irradiated DNA J. Biol. Chem. 252 1977 244 249
    • (1977) J. Biol. Chem. , vol.252 , pp. 244-249
    • Toulme, J.J.1    Helene, C.2
  • 37
    • 0028080844 scopus 로고
    • Effect of pH on interactions between DNA and high-mobility group protein HMG1
    • L.A. Kohlstaed, and R.D. Cole Effect of pH on interactions between DNA and high-mobility group protein HMG1 Biochemistry 33 1994 12702 12707
    • (1994) Biochemistry , vol.33 , pp. 12702-12707
    • Kohlstaed, L.A.1    Cole, R.D.2


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.