-
1
-
-
33947470407
-
Formation of a three-stranded polynucleotides molecule
-
G. Felsenfeld, D.R. Davis, and A. Rich Formation of a three-stranded polynucleotides molecule J. Am. Chem. Soc. 79 1957 2023 2024
-
(1957)
J. Am. Chem. Soc.
, vol.79
, pp. 2023-2024
-
-
Felsenfeld, G.1
Davis, D.R.2
Rich, A.3
-
3
-
-
0025270759
-
Sequence specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides
-
L. Perrouault, U. Aseline, C. Rivalle, N.T. Thuong, E. Bisagni, and C. Giovannangeli Sequence specific artificial photo-induced endonucleases based on triple helix-forming oligonucleotides Nature 344 1990 358 360
-
(1990)
Nature
, vol.344
, pp. 358-360
-
-
Perrouault, L.1
Aseline, U.2
Rivalle, C.3
Thuong, N.T.4
Bisagni, E.5
Giovannangeli, C.6
-
4
-
-
0025953701
-
Sequence specific photo-induced cross-linking of the two strands of double-helical DNA by a psoralen covalently linked to a triple helix-forming oligonucleotide
-
M. Takasugi, A. Guendouz, and M. Chassignol Sequence specific photo-induced cross-linking of the two strands of double-helical DNA by a psoralen covalently linked to a triple helix-forming oligonucleotide Proc. Natl. Acad. Sci. USA 88 1992 5602 5608
-
(1992)
Proc. Natl. Acad. Sci. USA
, vol.88
, pp. 5602-5608
-
-
Takasugi, M.1
Guendouz, A.2
Chassignol, M.3
-
5
-
-
0026739476
-
Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine and guanine
-
C. Giovannangeli, M. Rougee, T. Garestier, N.T. Thuong, and C. Helene Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine and guanine Proc. Natl. Acad. Sci. USA 89 1992 8631 8635
-
(1992)
Proc. Natl. Acad. Sci. USA
, vol.89
, pp. 8631-8635
-
-
Giovannangeli, C.1
Rougee, M.2
Garestier, T.3
Thuong, N.T.4
Helene, C.5
-
6
-
-
0024341224
-
Sequence specific intercalating agents: Intercalation at specific sequences on duplex dna via major groove recognition by oligonucleotide- intercalator conjugates
-
J.S. Sun, J.C. Francois, T. Garestier, T. Saison, V. Roig, N.T. Thuong, and C. Helene Sequence specific intercalating agents: intercalation at specific sequences on duplex dna via major groove recognition by oligonucleotide- intercalator conjugates Proc. Natl. Acad. Sci. USA 86 1989 9198 9202
-
(1989)
Proc. Natl. Acad. Sci. USA
, vol.86
, pp. 9198-9202
-
-
Sun, J.S.1
Francois, J.C.2
Garestier, T.3
Saison, T.4
Roig, V.5
Thuong, N.T.6
Helene, C.7
-
7
-
-
0026696129
-
Triple helix specific ligands
-
J.L. Mergny, G. Duval-Valentine, C.H. Nguyen, L. Perrouault, B. Faucon, and M. Rougee Triple helix specific ligands Science 256 1992 1681 1684
-
(1992)
Science
, vol.256
, pp. 1681-1684
-
-
Mergny, J.L.1
Duval-Valentine, G.2
Nguyen, C.H.3
Perrouault, L.4
Faucon, B.5
Rougee, M.6
-
8
-
-
0027183252
-
Characterization of a triple helix-specific ligand. BePI (3-methoxy-7H-8-methyl-11-[(3′-amino)propylamino]-benzo[e]pyrido[4,3-b] indole) intercalates into both double-helical and triple-helical DNA
-
D.S. Pilch, M.J. Waring, J.S. Sun, M. Rougee, C.H. Nguyen, E. Bisagni, T. Garestier, and C. Helene Characterization of a triple helix-specific ligand. BePI (3-methoxy-7H-8-methyl-11-[(3′-amino)propylamino]-benzo[e]pyrido[4,3- b]indole) intercalates into both double-helical and triple-helical DNA J. Mol. Biol. 232 1993 926 946
-
(1993)
J. Mol. Biol.
, vol.232
, pp. 926-946
-
-
Pilch, D.S.1
Waring, M.J.2
Sun, J.S.3
Rougee, M.4
Nguyen, C.H.5
Bisagni, E.6
Garestier, T.7
Helene, C.8
-
9
-
-
0028869131
-
Stabilization of triple helical nucleic acids by basic oligopeptides
-
V.N. Potaman, and R.R. Sinden Stabilization of triple helical nucleic acids by basic oligopeptides Biochemistry 34 1995 14885 14892
-
(1995)
Biochemistry
, vol.34
, pp. 14885-14892
-
-
Potaman, V.N.1
Sinden, R.R.2
-
10
-
-
0032530650
-
Stabilization of intermolecular triple/single-strand structure by cationic peptides
-
V.N. Potaman, and R.R. Sinden Stabilization of intermolecular triple/single-strand structure by cationic peptides Biochemistry 37 1998 12952 12961
-
(1998)
Biochemistry
, vol.37
, pp. 12952-12961
-
-
Potaman, V.N.1
Sinden, R.R.2
-
11
-
-
0034839608
-
Amphiphilic beta sheet peptides can bind to double and triple stranded DNA
-
K. Yokoyama, T. Kubo, and M. Fujii Amphiphilic beta sheet peptides can bind to double and triple stranded DNA Nucleosides Nucleotides Nucleic Acids 20 2001 1317 1320
-
(2001)
Nucleosides Nucleotides Nucleic Acids
, vol.20
, pp. 1317-1320
-
-
Yokoyama, K.1
Kubo, T.2
Fujii, M.3
-
12
-
-
0030725454
-
Trinucleotide repeats affect DNA replication in vivo
-
G.M. Samadashwily, G. Raca, and S.M. Mirkin Trinucleotide repeats affect DNA replication in vivo Nat. Genet. 17 1997 298 304
-
(1997)
Nat. Genet.
, vol.17
, pp. 298-304
-
-
Samadashwily, G.M.1
Raca, G.2
Mirkin, S.M.3
-
13
-
-
0029873571
-
Trinucleotide instability: A repeating theme in human inherited disorders
-
J.F. Gusella, and M.E. Mac Donald Trinucleotide instability: a repeating theme in human inherited disorders Annu. Rev. Med. 47 1996 201 209
-
(1996)
Annu. Rev. Med.
, vol.47
, pp. 201-209
-
-
Gusella, J.F.1
Mac Donald, M.E.2
-
14
-
-
0036127084
-
Formation and Thermodynamic stability of Intermolecular (R*R·Y) DNA triplex in GAA/TTC Repeats Associated with Friedreich's Ataxia
-
A. Jain, M.R. Rajeswari, and F. Ahmed Formation and Thermodynamic stability of Intermolecular (R*R·Y) DNA triplex In GAA/TTC Repeats Associated with Friedreich's Ataxia J. Biomol. Struct. Dyn. 19 2002 691 699
-
(2002)
J. Biomol. Struct. Dyn.
, vol.19
, pp. 691-699
-
-
Jain, A.1
Rajeswari, M.R.2
Ahmed, F.3
-
15
-
-
0028359704
-
DNA looping by the HMG-box domains of HMG1 and modulation of DNA binding by the acidic C-terminal domain
-
M. Stros, J. Strokrova, and J.O. Thomas DNA looping by the HMG-box domains of HMG1 and modulation of DNA binding by the acidic C-terminal domain Nucleic Acids Res. 22 1994 1041 1044
-
(1994)
Nucleic Acids Res.
, vol.22
, pp. 1041-1044
-
-
Stros, M.1
Strokrova, J.2
Thomas, J.O.3
-
16
-
-
0027414641
-
Structure of the HMG box motif in the B-domain of HMG1
-
H.M. Weir, P.J. Kraulis, C.S. Hill, A.R.C. Raine, E.D. Laue, and J.O. Thomas Structure of the HMG box motif in the B-domain of HMG1 EMBO J. 12 1993 1311 1319
-
(1993)
EMBO J.
, vol.12
, pp. 1311-1319
-
-
Weir, H.M.1
Kraulis, P.J.2
Hill, C.S.3
Raine, A.R.C.4
Laue, E.D.5
Thomas, J.O.6
-
17
-
-
0029848281
-
A novel activity of HMG domains: Promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides
-
T. Suda, Y. Mishima, K. Takayanagi, H. Asakura, S. Odani, and R. Kominami A novel activity of HMG domains: promotion of the triple-stranded complex formation between DNA containing (GGA/TCC)11 and d(GGA)11 oligonucleotides Nucleic Acids Res. 24 1996 4733 4740
-
(1996)
Nucleic Acids Res.
, vol.24
, pp. 4733-4740
-
-
Suda, T.1
Mishima, Y.2
Takayanagi, K.3
Asakura, H.4
Odani, S.5
Kominami, R.6
-
18
-
-
0014725117
-
Oligonucleotide interactions: Circular dichroism studies of the conformations of deoxy-oligonucleotides
-
C.R. Cantor, M.M. Warshaw, and H. Shapiro Oligonucleotide interactions: circular dichroism studies of the conformations of deoxy-oligonucleotides Biopolymers 9 1970 1059 1077
-
(1970)
Biopolymers
, vol.9
, pp. 1059-1077
-
-
Cantor, C.R.1
Warshaw, M.M.2
Shapiro, H.3
-
19
-
-
0023661021
-
Does tryptophan intercalate in DNA? a comparative study of peptide binding to alternating and nonalternating A.T sequences
-
M.R. Rajeswari, T. Garestier, and C. Helene Does tryptophan intercalate in DNA? A comparative study of peptide binding to alternating and nonalternating A.T sequences Biochemistry 26 1987 6825 6831
-
(1987)
Biochemistry
, vol.26
, pp. 6825-6831
-
-
Rajeswari, M.R.1
Garestier, T.2
Helene, C.3
-
20
-
-
0023406843
-
Calculating Thermodynamic data for transitions of and molecularity from equilibrium melting curves
-
L.A. Marky, and K.J. Breslauer Calculating Thermodynamic data for transitions of and molecularity from equilibrium melting curves Biopolymers 26 1987 1601 1620
-
(1987)
Biopolymers
, vol.26
, pp. 1601-1620
-
-
Marky, L.A.1
Breslauer, K.J.2
-
21
-
-
0029090754
-
Characterization of the DNA triplex formed by d (TGGGTCCCTGCGGTTGGGTGGG) and critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene
-
L.E. Xodo Characterization of the DNA triplex formed by d (TGGGTCCCTGCGGTTGGGTGGG) and critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene FEBS Lett. 370 1995 153 157
-
(1995)
FEBS Lett.
, vol.370
, pp. 153-157
-
-
Xodo, L.E.1
-
22
-
-
0026748690
-
Binding of oligopeptides d-AGATCTAGATCT and d-AAGCTTAAGCTT: Can tryptophan intercalate in DNA hairpins?
-
M.R. Rajeswari, H.S. Bose, S. Kukreti, A. Gupta, V.S. Chauhan, and K.B. Roy Binding of oligopeptides d-AGATCTAGATCT and d-AAGCTTAAGCTT: can tryptophan intercalate in DNA hairpins? Biochemistry 31 1992 6237 6241
-
(1992)
Biochemistry
, vol.31
, pp. 6237-6241
-
-
Rajeswari, M.R.1
Bose, H.S.2
Kukreti, S.3
Gupta, A.4
Chauhan, V.S.5
Roy, K.B.6
-
23
-
-
0029811874
-
Tryptophan intercalation in G, C containing polynucleotides Z to B conversion of poly [d(G-5MC)] in low salt induced by a tetrapeptide
-
M.R. Rajeswari Tryptophan intercalation in G, C containing polynucleotides Z to B conversion of poly [d(G-5MC)] in low salt induced by a tetrapeptide J. Biomol. Struct. Dyn. 14 1996 25 30
-
(1996)
J. Biomol. Struct. Dyn.
, vol.14
, pp. 25-30
-
-
Rajeswari, M.R.1
-
24
-
-
0036804485
-
Preferential binding of quinolones to DNA with alternating G, C/A, T sequences: A spectroscopic study
-
A. Jain, and M.R. Rajeswari Preferential binding of quinolones to DNA with alternating G, C/A, T sequences: a spectroscopic study J. Biomol. Struct. Dyn. 20 2002 291 299
-
(2002)
J. Biomol. Struct. Dyn.
, vol.20
, pp. 291-299
-
-
Jain, A.1
Rajeswari, M.R.2
-
25
-
-
0037767737
-
A. Jain, M.R. Rajeswari, Binding studies on peptide-oligonucleotide complex: Intercalation of tryptophan in GC-rich region of c-myc gene
-
S. Akanchha A. Jain, M.R. Rajeswari, Binding studies on peptide-oligonucleotide complex: intercalation of tryptophan in GC-rich region of c-myc gene Biochim. Biophys. Acta 1622 2003 73 81
-
(2003)
Biochim. Biophys. Acta
, vol.1622
, pp. 73-81
-
-
Akanchha, S.1
-
26
-
-
0017116135
-
Theoretical calculations of the helix-coil transition of DNA in the presence of large, cooperatively binding ligands
-
J.D. McGhee Theoretical calculations of the helix-coil transition of DNA in the presence of large, cooperatively binding ligands Biopolymers 15 1976 1345 1375
-
(1976)
Biopolymers
, vol.15
, pp. 1345-1375
-
-
McGhee, J.D.1
-
27
-
-
0033291983
-
Interaction of amphiphilic cyclic peptide with double and triple stranded DNA
-
K. Yokoyama, T. Kubo, and M. Fujii Interaction of amphiphilic cyclic peptide with double and triple stranded DNA Nucleic Acids Symp. Ser. 42 1999 169 170
-
(1999)
Nucleic Acids Symp. Ser.
, vol.42
, pp. 169-170
-
-
Yokoyama, K.1
Kubo, T.2
Fujii, M.3
-
28
-
-
0020012345
-
Interactions between functional groups in protein-nucleic acid associations
-
C. Helene, and G. Lancelot Interactions between functional groups in protein-nucleic acid associations Prog. Biophys. Mol. Biol. 39 1982 1 68
-
(1982)
Prog. Biophys. Mol. Biol.
, vol.39
, pp. 1-68
-
-
Helene, C.1
Lancelot, G.2
-
29
-
-
0031553987
-
Studies on formation and stability of the d[G(AG)5]* d[G(AG)5]. d[C(TC)5] and d[G(TG)5]*d[G(AG)5]. d[C(TC)5] triple helices
-
Y. He, P.V. Scaria, and R.H. Shafer Studies on formation and stability of the d[G(AG)5]* d[G(AG)5]. d[C(TC)5] and d[G(TG)5]*d[G(AG)5]. d[C(TC)5] triple helices Biopolymers 41 1997 431 441
-
(1997)
Biopolymers
, vol.41
, pp. 431-441
-
-
He, Y.1
Scaria, P.V.2
Shafer, R.H.3
-
30
-
-
0029658622
-
Single stand targeted triplex formation: Physicochemical and biochemical properties of fold back triplexes
-
E.R. Kandimalla, A. Manning, and S. Aggrawal Single stand targeted triplex formation: physicochemical and biochemical properties of fold back triplexes J. Biomol. Struct. Dyn. 14 1996 79 90
-
(1996)
J. Biomol. Struct. Dyn.
, vol.14
, pp. 79-90
-
-
Kandimalla, E.R.1
Manning, A.2
Aggrawal, S.3
-
31
-
-
0003940109
-
-
V. Hruby Academic Press New York
-
R.W. Woody V. Hruby 'The peptides' 1985 Academic Press New York vol. 7, Chapter 2
-
(1985)
'The Peptides'
-
-
Woody, R.W.1
-
32
-
-
0015912223
-
Far-ultraviolet absorption and circular dichroism spectra of l-tryptophan and some derivatives
-
H.E. Auer Far-ultraviolet absorption and circular dichroism spectra of l-tryptophan and some derivatives J. Am. Chem. Soc. 95 1973 3003 3011
-
(1973)
J. Am. Chem. Soc.
, vol.95
, pp. 3003-3011
-
-
Auer, H.E.1
-
33
-
-
0016663420
-
Interaction of aromatic residues of proteins with nucleic acids. Circular dichroism studies of the binding of oligopeptides to poly (adenylic acid)
-
F. Brun, J.J. Toulme, and C. Helene Interaction of aromatic residues of proteins with nucleic acids. Circular dichroism studies of the binding of oligopeptides to poly (adenylic acid) Biochemistry 14 1975 558 563
-
(1975)
Biochemistry
, vol.14
, pp. 558-563
-
-
Brun, F.1
Toulme, J.J.2
Helene, C.3
-
34
-
-
0015231794
-
Reflectance and luminescence studies of molecular complex formation between tryptophan and nucleic acid components in frozen aqueous solutions
-
T. Gerestier, and C. Helene Reflectance and luminescence studies of molecular complex formation between tryptophan and nucleic acid components in frozen aqueous solutions Biochemistry 10 1971 300 306
-
(1971)
Biochemistry
, vol.10
, pp. 300-306
-
-
Gerestier, T.1
Helene, C.2
-
35
-
-
0019399694
-
Interactions of oligopeptides with nucleic acids
-
C. Helene, and J.C. Maurizot Interactions of oligopeptides with nucleic acids CRC Crit. Rev. Biochem. 10 1981 213 258
-
(1981)
CRC Crit. Rev. Biochem.
, vol.10
, pp. 213-258
-
-
Helene, C.1
Maurizot, J.C.2
-
36
-
-
0017600319
-
Specific recognition of single-stranded nucleic acids interaction of tryptophan-containing peptides with native, denatured and ultraviolet-irradiated DNA
-
J.J. Toulme, and C. Helene Specific recognition of single-stranded nucleic acids interaction of tryptophan-containing peptides with native, denatured and ultraviolet-irradiated DNA J. Biol. Chem. 252 1977 244 249
-
(1977)
J. Biol. Chem.
, vol.252
, pp. 244-249
-
-
Toulme, J.J.1
Helene, C.2
-
37
-
-
0028080844
-
Effect of pH on interactions between DNA and high-mobility group protein HMG1
-
L.A. Kohlstaed, and R.D. Cole Effect of pH on interactions between DNA and high-mobility group protein HMG1 Biochemistry 33 1994 12702 12707
-
(1994)
Biochemistry
, vol.33
, pp. 12702-12707
-
-
Kohlstaed, L.A.1
Cole, R.D.2
|