Single-molecule measurements of gold-quenched quantum dots

Physical Review Letters

Volumn 93, Issue 16, 2004, Pages

  Gueroui, Zoher ^a   Libchaber, Albert ^a  

^a ROCKEFELLER UNIVERSITY   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

DNA; FLUORESCENCE; GOLD COMPOUNDS; LUMINESCENCE; MICELLES; NANOSTRUCTURED MATERIALS; PHOSPHOLIPIDS; PLASMA ACCELERATORS; QUENCHING; RESONANCE;

DISTANCE-DEPENDENT QUENCHING; FLUORESCENCE INTERMITTENCY; FLUORESCENT INTENSITY DISTRIBUTION; GOLD NANOPARTICLES;

SEMICONDUCTOR QUANTUM DOTS;

EID: 19644401469     PISSN: 00319007     EISSN: None     Source Type: Journal    
DOI: 10.1103/PhysRevLett.93.166108     Document Type: Article

References (30)

1. S. Weiss, Science 283, 1676 (1999).
2. J. R. Lakowicz, Principles of Fluorescence Spectroscopy (Kluwer Academic/Plenum Publisher, New York, 1999).
3. L. Stryer and R. P. Haugland, Proc. Natl. Acad. Sci. U.S.A. 58, 719 (1967); T. Ha et al., Proc. Natl. Acad. Sci. U.S.A. 93, 6264 (1996).
4. L. Stryer and R. P. Haugland, Proc. Natl. Acad. Sci. U.S.A. 58, 719 (1967); T. Ha et al., Proc. Natl. Acad. Sci. U.S.A. 93, 6264 (1996).
5. A. P. Alivisatos, Science 271, 933 (1996).
6. M. Jr. Bruchez, M. Moronne, P. Gin, S. Weiss, and A. P. Alivisatos, Science 281, 2013 (1998).
7. I. L. Medintz et al., Nat. Mater. 2, 630 (2003).
8. V. I. Klimov et al., Science 290, 314 (2000).
9. P. Michler et al., Nature (London) 406, 968 (2000).
10. M. A. Hines and P. Guyot-Sionnest, J. Phys. Chem. 100, 468 (1996).
11. C. B. Murray, D. J. Norris, and M. G. Bawendi, J. Am. Chem. Soc. 115, 8706 (1993).
12. A. P. Alivisatos, Nat Biotechnol. 22, 47 (2004).
13. C. F. Bohren and D. R. Huffman, Absorption and Scattering of Light by Small Particles (Wiley Science, New York, 1998).
14. B. Dubertret, M. Calame, and A. Libchaber, Nat Biotechnol. 19, 365 (2001).
15. H. Du, M. D. Disney, B. L. Miller, and T. D. Krauss, J. Am. Chem. Soc. 125, 4012 (2003).
16. E. Dulkeith et al., Phys. Rev. Lett. 89, 203002 (2002).
17. N. C. Seeman, Nature (London) 421, 427 (2003).
18. Double-stranded DNA shorter than 150 bp can be considered as rigid molecules. A. A. Deniz et al., Proc. Natl. Acad. Sci. U.S.A. 96, 3670 (1999).
19. A. P. Alivisatos et al., Nature (London) 382, 609 (1996).
20. B. Dubertret et al., Science 298, 1759 (2002).
21. Zucker's DNA mfold server was used to simulate conformation of oligonucleotides at room temperature. M. Zuker, Nucleic Acids Res. 31, 3406 (2003). Four DNA sequences were chosen: 5' TTTGAGC 3', 5' TTTTGAGCGCG 3', 5' TTTTCCACATCCTCT 3', 5' TTTTGCTCAGTTCGAATGGAC 3'.
22. G. T. Hermanson, Bioconjugate Techniques (Academic, San Diego, 1996).
23. ssDNA-nanoparticles are mixed together (120 n m final) in a SSC buffer (1 ×) for 15 min at 38°C and then left cooled at 20°C for 105 min.
24. Y. Ebenstein, T. Mokari, and U. Banin, Appl. Phys. Lett. 80, 4033 (2002).
25. K. T. Shimizu et al., Phys. Rev. B 63, 205316 (2001).
26. X. Brokmann et al., Phys. Rev. Lett. 90, 120601 (2003).
27. I. Chung, K. T. Shimizu, and M. G. Bawendi, Proc. Natl. Acad. Sci. U.S.A. 100, 405 (2003).
28. Tuning the excitation wavelengths (410 to 460 nm) does not change the general aspect of the emission spectrum. In the Fig. 4, the spectrum for a 430 nm excitation wavelength is reported The ratio between the fluorescent intensity of the experiments (iii) and (ii), R , allows one to determine the quenching efficiency P = (1 - R). In these experiments, we had systematically subtracted the fluorescent background by doing a measurement without qdots and gold. We idealized the hybridization scheme by assuming 100% efficiencies for both conjugation and target hybridization.
29. The same results are observed with CdSe nanocrystals emitting at 546 nm.
30. R. H. Doremus, J. Chem. Phys. 40, 2389 (1964).