메뉴 건너뛰기




Volumn 93, Issue 16, 2004, Pages

Single-molecule measurements of gold-quenched quantum dots

Author keywords

[No Author keywords available]

Indexed keywords

DNA; FLUORESCENCE; GOLD COMPOUNDS; LUMINESCENCE; MICELLES; NANOSTRUCTURED MATERIALS; PHOSPHOLIPIDS; PLASMA ACCELERATORS; QUENCHING; RESONANCE;

EID: 19644401469     PISSN: 00319007     EISSN: None     Source Type: Journal    
DOI: 10.1103/PhysRevLett.93.166108     Document Type: Article
Times cited : (251)

References (30)
  • 1
    • 0033548686 scopus 로고    scopus 로고
    • S. Weiss, Science 283, 1676 (1999).
    • (1999) Science , vol.283 , pp. 1676
    • Weiss, S.1
  • 4
    • 0029987587 scopus 로고    scopus 로고
    • L. Stryer and R. P. Haugland, Proc. Natl. Acad. Sci. U.S.A. 58, 719 (1967); T. Ha et al., Proc. Natl. Acad. Sci. U.S.A. 93, 6264 (1996).
    • (1996) Proc. Natl. Acad. Sci. U.S.A. , vol.93 , pp. 6264
    • Ha, T.1
  • 8
    • 0034644601 scopus 로고    scopus 로고
    • V. I. Klimov et al., Science 290, 314 (2000).
    • (2000) Science , vol.290 , pp. 314
    • Klimov, V.I.1
  • 18
    • 0033616580 scopus 로고    scopus 로고
    • Double-stranded DNA shorter than 150 bp can be considered as rigid molecules. A. A. Deniz et al., Proc. Natl. Acad. Sci. U.S.A. 96, 3670 (1999).
    • (1999) Proc. Natl. Acad. Sci. U.S.A. , vol.96 , pp. 3670
    • Deniz, A.A.1
  • 20
    • 2242495402 scopus 로고    scopus 로고
    • B. Dubertret et al., Science 298, 1759 (2002).
    • (2002) Science , vol.298 , pp. 1759
    • Dubertret, B.1
  • 21
    • 0042121256 scopus 로고    scopus 로고
    • Zucker's DNA mfold server was used to simulate conformation of oligonucleotides at room temperature. M. Zuker, Nucleic Acids Res. 31, 3406 (2003). Four DNA sequences were chosen: 5' TTTGAGC 3', 5' TTTTGAGCGCG 3', 5' TTTTCCACATCCTCT 3', 5' TTTTGCTCAGTTCGAATGGAC 3'.
    • (2003) Nucleic Acids Res. , vol.31 , pp. 3406
    • Zuker, M.1
  • 23
    • 8644228978 scopus 로고    scopus 로고
    • note
    • ssDNA-nanoparticles are mixed together (120 n m final) in a SSC buffer (1 ×) for 15 min at 38°C and then left cooled at 20°C for 105 min.
  • 28
    • 8644241375 scopus 로고    scopus 로고
    • note
    • Tuning the excitation wavelengths (410 to 460 nm) does not change the general aspect of the emission spectrum. In the Fig. 4, the spectrum for a 430 nm excitation wavelength is reported The ratio between the fluorescent intensity of the experiments (iii) and (ii), R , allows one to determine the quenching efficiency P = (1 - R). In these experiments, we had systematically subtracted the fluorescent background by doing a measurement without qdots and gold. We idealized the hybridization scheme by assuming 100% efficiencies for both conjugation and target hybridization.
  • 29
    • 8644265628 scopus 로고    scopus 로고
    • note
    • The same results are observed with CdSe nanocrystals emitting at 546 nm.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.