메뉴 건너뛰기




Volumn 284, Issue 5420, 1999, Pages 1664-1666

Purification and cloning of aggrecanase-1: A member of the ADAMTS family of proteins

Author keywords

[No Author keywords available]

Indexed keywords

AGGRECAN; AGGRECANASE 1; DISINTEGRIN; METALLOPROTEINASE; PROTEINASE; THROMBOSPONDIN; UNCLASSIFIED DRUG;

EID: 0345211445     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.284.5420.1664     Document Type: Article
Times cited : (639)

References (34)
  • 1
    • 0026040194 scopus 로고
    • A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
    • (1991) J. Biol. Chem. , vol.266 , pp. 15579
    • Fosang, A.J.1    Neame, T.J.2    Hardingham, T.E.3    Murphy, G.4    Hamilton, J.A.5
  • 2
    • 0026504563 scopus 로고
    • A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
    • (1992) J. Biol. Chem. , vol.267 , pp. 1008
    • Flannery, C.R.1    Lark, M.W.2    Sandy, J.D.3
  • 3
    • 0027369012 scopus 로고
    • A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
    • (1993) Biochem. J. , vol.295 , pp. 273
    • Fosang, A.J.1
  • 4
    • 0030024311 scopus 로고    scopus 로고
    • A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
    • (1996) FEBS Lett. , vol.380 , pp. 17
    • Fosang, A.J.1    Last, K.2    Knauper, V.3    Murphy, G.4    Neame, P.J.5
  • 5
    • 0025776382 scopus 로고
    • J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
    • (1991) J. Biol. Chem. , vol.266 , pp. 8683
    • Sandy, J.D.1    Neame, P.J.2    Boynton, P.L.3    Flannery, C.R.4
  • 6
    • 0025776382 scopus 로고
    • J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
    • (1992) Biochem. J. , vol.264 , pp. 589
    • Leulakis, P.1    Shirkhanda, A.V.2    Davis, G.3    Maniglia, C.A.4
  • 7
    • 0026533115 scopus 로고
    • J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
    • (1992) Arch. Biochem. Biophys. , vol.294 , pp. 115
    • Ilic, M.Z.1    Handley, C.J.2    Robinson, H.C.3    Mok, M.T.4
  • 14
    • 0344707809 scopus 로고    scopus 로고
    • note
    • 2; dialyzed; and analyzed for aggrecanase activity (6).
  • 16
    • 0024284041 scopus 로고
    • Sequences were amplified from human heart cDNA (Clontech, Palo Alto, CA) with PCR primers designed from murine EST 474985 (GGGGGTGGTGTCCAGTT-CTCC and GGCCCTGGAAAGCTCTTGAAGAG). Primers were designed from the resulting PCR product (CCAGTTGGGCAGTCCTCAGTGTT and GGTCGGT-GCGGTGGTTGTAGGC) and were used to amplify a 2.2-kb 5′ rapid amplification of cDNA ends (RACE) product from heart cDNA with the Marathon cDNA Amplification System (Clontech). In addition, the IM-AGE consortium [G. Lennon, C. Auffray, M. Polymeropoulos, M. B. Soares, Genomics 33, 151 (1996)] clone corresponding to EST 474985 was sequenced in its entirety and used to identify a human EST (GenBank accession number D45652) containing sequences from the 3′ untranslated region of the gene. Primers designed from the human PCR product (CCCCG-GAATGGTGGCAAGTACTG) and from the human EST (ACCCACATCTGTCTGACTCCAAA) were used to amplify sequences from the 3′ end of the transcript from human heart cDNA. A full-length ORF was assembled with a 5′ RACE clone and a 3′ fragment obtained by RT-PCR. Expression vectors containing the full-length ORF were assembled for subcloning into the pRMHA3 [T. A. Bunch, Y. Grinblat, L. S. Goldstein, Nucleic Acids Res. 16, 1043 (1988)] for Drosophila S2 expression as described [D. C. Rio and G. M. Rubin, Mol. Cell Biol. 5, 1833 (1985)].
    • (1988) Nucleic Acids Res. , vol.16 , pp. 1043
    • Bunch, T.A.1    Grinblat, Y.2    Goldstein, L.S.3
  • 17
    • 0021859522 scopus 로고
    • Sequences were amplified from human heart cDNA (Clontech, Palo Alto, CA) with PCR primers designed from murine EST 474985 (GGGGGTGGTGTCCAGTT-CTCC and GGCCCTGGAAAGCTCTTGAAGAG). Primers were designed from the resulting PCR product (CCAGTTGGGCAGTCCTCAGTGTT and GGTCGGT-GCGGTGGTTGTAGGC) and were used to amplify a 2.2-kb 5′ rapid amplification of cDNA ends (RACE) product from heart cDNA with the Marathon cDNA Amplification System (Clontech). In addition, the IM-AGE consortium [G. Lennon, C. Auffray, M. Polymeropoulos, M. B. Soares, Genomics 33, 151 (1996)] clone corresponding to EST 474985 was sequenced in its entirety and used to identify a human EST (GenBank accession number D45652) containing sequences from the 3′ untranslated region of the gene. Primers designed from the human PCR product (CCCCG-GAATGGTGGCAAGTACTG) and from the human EST (ACCCACATCTGTCTGACTCCAAA) were used to amplify sequences from the 3′ end of the transcript from human heart cDNA. A full-length ORF was assembled with a 5′ RACE clone and a 3′ fragment obtained by RT-PCR. Expression vectors containing the full-length ORF were assembled for subcloning into the pRMHA3 [T. A. Bunch, Y. Grinblat, L. S. Goldstein, Nucleic Acids Res. 16, 1043 (1988)] for Drosophila S2 expression as described [D. C. Rio and G. M. Rubin, Mol. Cell Biol. 5, 1833 (1985)].
    • (1985) Mol. Cell Biol. , vol.5 , pp. 1833
    • Rio, D.C.1    Rubin, G.M.2
  • 18
    • 0344275879 scopus 로고    scopus 로고
    • unpublished results
    • K. Solomon, unpublished results.
    • Solomon, K.1
  • 20
    • 0025733702 scopus 로고
    • P. J. Barr, Cell 66, 1 (1991).
    • (1991) Cell , vol.66 , pp. 1
    • Barr, P.J.1
  • 21
    • 0345138379 scopus 로고    scopus 로고
    • note
    • Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; X, any amino acid; and Y, Tyr.
  • 25
    • 0026673905 scopus 로고
    • N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
    • (1992) J. Biol. Chem. , vol.267 , pp. 19349
    • Guo, N.-H.1    Krutzsch, H.C.2    Negre, E.3    Zabrenetzky, V.S.4    Roberts, D.D.5
  • 26
    • 0025977372 scopus 로고
    • N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
    • (1991) J. Cell Biol. , vol.112 , pp. 1031
    • Prater, C.A.1    Plotkin, J.2    Jaye, D.3    Frazier, W.A.4
  • 27
    • 0030739102 scopus 로고    scopus 로고
    • N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
    • (1997) J. Biol. Chem. , vol.272 , pp. 19205
    • Gantt, S.M.1    Clavijo, P.2    Bai, X.3    Esko, J.D.4    Sinnis, P.5
  • 30
    • 0345138378 scopus 로고    scopus 로고
    • note
    • Samples were separated by SDS-PAGE with 4 to 12% tris glycine gels, transferred to PVDF membranes, and probed with a rabbit polyclonal antibody to peptide, which recognizes the sequence VMAHVDPEEP (14) (residues 393 to 403 in Fig. 2A). The membranes were incubated with goat antimouse IgG alkaline phosphatase conjugate and visualized by incubation with NBT/BCIP substrate.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.