-
1
-
-
0026040194
-
-
A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
-
(1991)
J. Biol. Chem.
, vol.266
, pp. 15579
-
-
Fosang, A.J.1
Neame, T.J.2
Hardingham, T.E.3
Murphy, G.4
Hamilton, J.A.5
-
2
-
-
0026504563
-
-
A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
-
(1992)
J. Biol. Chem.
, vol.267
, pp. 1008
-
-
Flannery, C.R.1
Lark, M.W.2
Sandy, J.D.3
-
3
-
-
0027369012
-
-
A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
-
(1993)
Biochem. J.
, vol.295
, pp. 273
-
-
Fosang, A.J.1
-
4
-
-
0030024311
-
-
A. J. Fosang, T. J. Neame, T. E. Hardingham, G. Murphy, J. A. Hamilton, J. Biol. Chem. 266, 15579 (1991); C. R. Flannery, M. W. Lark, J. D. Sandy, ibid. 267, 1008 (1992); A. J. Fosang et al., Biochem. J. 295, 273 (1993); A. J. Fosang, K. Last, V. Knauper, G. Murphy, P. J. Neame, FEBS Lett. 380, 17 (1996).
-
(1996)
FEBS Lett.
, vol.380
, pp. 17
-
-
Fosang, A.J.1
Last, K.2
Knauper, V.3
Murphy, G.4
Neame, P.J.5
-
5
-
-
0025776382
-
-
J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
-
(1991)
J. Biol. Chem.
, vol.266
, pp. 8683
-
-
Sandy, J.D.1
Neame, P.J.2
Boynton, P.L.3
Flannery, C.R.4
-
6
-
-
0025776382
-
-
J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
-
(1992)
Biochem. J.
, vol.264
, pp. 589
-
-
Leulakis, P.1
Shirkhanda, A.V.2
Davis, G.3
Maniglia, C.A.4
-
7
-
-
0026533115
-
-
J. D. Sandy, P. J. Neame, P. L. Boynton, C. R. Flannery, J. Biol. Chem. 266, 8683 (1991); P. Leulakis, A. V. Shirkhanda, G. Davis, C. A. Maniglia, Biochem. J. 264, 589 (1992); M. Z. Ilic, C. J. Handley, H. C. Robinson, M. T. Mok, Arch. Biochem. Biophys. 294, 115 (1992).
-
(1992)
Arch. Biochem. Biophys.
, vol.294
, pp. 115
-
-
Ilic, M.Z.1
Handley, C.J.2
Robinson, H.C.3
Mok, M.T.4
-
9
-
-
0032076280
-
-
E. C. Arner, C. E. Hughes, C. P. Decicco, B. Caterson, M. D. Tortorella, Osteoarthritis Cartilage 6, 214 (1998).
-
(1998)
Osteoarthritis Cartilage
, vol.6
, pp. 214
-
-
Arner, E.C.1
Hughes, C.E.2
Decicco, C.P.3
Caterson, B.4
Tortorella, M.D.5
-
10
-
-
0026682509
-
-
J. D. Sandy, C. R. Flannery, P. J. Neame, L. S. Lohmander, J. Clin. Invest. 89, 1512 (1992); L. S. Lohmander, P. J. Neame, J. D. Sandy, Arthritis Rheum. 36, 1214 (1993).
-
(1992)
J. Clin. Invest.
, vol.89
, pp. 1512
-
-
Sandy, J.D.1
Flannery, C.R.2
Neame, P.J.3
Lohmander, L.S.4
-
11
-
-
0027445981
-
-
J. D. Sandy, C. R. Flannery, P. J. Neame, L. S. Lohmander, J. Clin. Invest. 89, 1512 (1992); L. S. Lohmander, P. J. Neame, J. D. Sandy, Arthritis Rheum. 36, 1214 (1993).
-
(1993)
Arthritis Rheum.
, vol.36
, pp. 1214
-
-
Lohmander, L.S.1
Neame, P.J.2
Sandy, J.D.3
-
12
-
-
0033525533
-
-
E. C. Arner, M. A. Pratta, J. M. Trzaskos, C. P. Decicco, M. D. Tortorella, J. Biol. Chem. 274, 6594 (1999).
-
(1999)
J. Biol. Chem.
, vol.274
, pp. 6594
-
-
Arner, E.C.1
Pratta, M.A.2
Trzaskos, J.M.3
Decicco, C.P.4
Tortorella, M.D.5
-
14
-
-
0344707809
-
-
note
-
2; dialyzed; and analyzed for aggrecanase activity (6).
-
-
-
-
16
-
-
0024284041
-
-
Sequences were amplified from human heart cDNA (Clontech, Palo Alto, CA) with PCR primers designed from murine EST 474985 (GGGGGTGGTGTCCAGTT-CTCC and GGCCCTGGAAAGCTCTTGAAGAG). Primers were designed from the resulting PCR product (CCAGTTGGGCAGTCCTCAGTGTT and GGTCGGT-GCGGTGGTTGTAGGC) and were used to amplify a 2.2-kb 5′ rapid amplification of cDNA ends (RACE) product from heart cDNA with the Marathon cDNA Amplification System (Clontech). In addition, the IM-AGE consortium [G. Lennon, C. Auffray, M. Polymeropoulos, M. B. Soares, Genomics 33, 151 (1996)] clone corresponding to EST 474985 was sequenced in its entirety and used to identify a human EST (GenBank accession number D45652) containing sequences from the 3′ untranslated region of the gene. Primers designed from the human PCR product (CCCCG-GAATGGTGGCAAGTACTG) and from the human EST (ACCCACATCTGTCTGACTCCAAA) were used to amplify sequences from the 3′ end of the transcript from human heart cDNA. A full-length ORF was assembled with a 5′ RACE clone and a 3′ fragment obtained by RT-PCR. Expression vectors containing the full-length ORF were assembled for subcloning into the pRMHA3 [T. A. Bunch, Y. Grinblat, L. S. Goldstein, Nucleic Acids Res. 16, 1043 (1988)] for Drosophila S2 expression as described [D. C. Rio and G. M. Rubin, Mol. Cell Biol. 5, 1833 (1985)].
-
(1988)
Nucleic Acids Res.
, vol.16
, pp. 1043
-
-
Bunch, T.A.1
Grinblat, Y.2
Goldstein, L.S.3
-
17
-
-
0021859522
-
-
Sequences were amplified from human heart cDNA (Clontech, Palo Alto, CA) with PCR primers designed from murine EST 474985 (GGGGGTGGTGTCCAGTT-CTCC and GGCCCTGGAAAGCTCTTGAAGAG). Primers were designed from the resulting PCR product (CCAGTTGGGCAGTCCTCAGTGTT and GGTCGGT-GCGGTGGTTGTAGGC) and were used to amplify a 2.2-kb 5′ rapid amplification of cDNA ends (RACE) product from heart cDNA with the Marathon cDNA Amplification System (Clontech). In addition, the IM-AGE consortium [G. Lennon, C. Auffray, M. Polymeropoulos, M. B. Soares, Genomics 33, 151 (1996)] clone corresponding to EST 474985 was sequenced in its entirety and used to identify a human EST (GenBank accession number D45652) containing sequences from the 3′ untranslated region of the gene. Primers designed from the human PCR product (CCCCG-GAATGGTGGCAAGTACTG) and from the human EST (ACCCACATCTGTCTGACTCCAAA) were used to amplify sequences from the 3′ end of the transcript from human heart cDNA. A full-length ORF was assembled with a 5′ RACE clone and a 3′ fragment obtained by RT-PCR. Expression vectors containing the full-length ORF were assembled for subcloning into the pRMHA3 [T. A. Bunch, Y. Grinblat, L. S. Goldstein, Nucleic Acids Res. 16, 1043 (1988)] for Drosophila S2 expression as described [D. C. Rio and G. M. Rubin, Mol. Cell Biol. 5, 1833 (1985)].
-
(1985)
Mol. Cell Biol.
, vol.5
, pp. 1833
-
-
Rio, D.C.1
Rubin, G.M.2
-
18
-
-
0344275879
-
-
unpublished results
-
K. Solomon, unpublished results.
-
-
-
Solomon, K.1
-
20
-
-
0025733702
-
-
P. J. Barr, Cell 66, 1 (1991).
-
(1991)
Cell
, vol.66
, pp. 1
-
-
Barr, P.J.1
-
21
-
-
0345138379
-
-
note
-
Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; X, any amino acid; and Y, Tyr.
-
-
-
-
23
-
-
0027248462
-
-
J. Durr, S. Goodman, A. Potocnik, H. von der Mark, K. van der Mark, Exp. Cell Res. 207, 235 (1993); D. M. Salter, L. D. E. Huges, R. Simpson, D. L. Gardner, Br. J. Rheumatol. 31, 231 (1992).
-
(1993)
Exp. Cell Res.
, vol.207
, pp. 235
-
-
Durr, J.1
Goodman, S.2
Potocnik, A.3
Von Der Mark, H.4
Van Der Mark, K.5
-
24
-
-
0026508044
-
-
J. Durr, S. Goodman, A. Potocnik, H. von der Mark, K. van der Mark, Exp. Cell Res. 207, 235 (1993); D. M. Salter, L. D. E. Huges, R. Simpson, D. L. Gardner, Br. J. Rheumatol. 31, 231 (1992).
-
(1992)
Br. J. Rheumatol.
, vol.31
, pp. 231
-
-
Salter, D.M.1
Huges, L.D.E.2
Simpson, R.3
Gardner, D.L.4
-
25
-
-
0026673905
-
-
N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
-
(1992)
J. Biol. Chem.
, vol.267
, pp. 19349
-
-
Guo, N.-H.1
Krutzsch, H.C.2
Negre, E.3
Zabrenetzky, V.S.4
Roberts, D.D.5
-
26
-
-
0025977372
-
-
N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
-
(1991)
J. Cell Biol.
, vol.112
, pp. 1031
-
-
Prater, C.A.1
Plotkin, J.2
Jaye, D.3
Frazier, W.A.4
-
27
-
-
0030739102
-
-
N.-H. Guo, H. C. Krutzsch, E. Negre, V. S. Zabrenetzky, D. D. Roberts, J. Biol. Chem. 267, 19349 (1992); C. A. Prater, J. Plotkin, D. Jaye, W. A. Frazier, J. Cell Biol. 112, 1031 (1991); S. M. Gantt, P. Clavijo, X. Bai, J. D. Esko, P. Sinnis, J. Biol. Chem. 272, 19205 (1997).
-
(1997)
J. Biol. Chem.
, vol.272
, pp. 19205
-
-
Gantt, S.M.1
Clavijo, P.2
Bai, X.3
Esko, J.D.4
Sinnis, P.5
-
30
-
-
0345138378
-
-
note
-
Samples were separated by SDS-PAGE with 4 to 12% tris glycine gels, transferred to PVDF membranes, and probed with a rabbit polyclonal antibody to peptide, which recognizes the sequence VMAHVDPEEP (14) (residues 393 to 403 in Fig. 2A). The membranes were incubated with goat antimouse IgG alkaline phosphatase conjugate and visualized by incubation with NBT/BCIP substrate.
-
-
-
|