메뉴 건너뛰기




Volumn 289, Issue 5477, 2000, Pages 310-313

Induction of mating in Candida albicans by construction of MTLa and MTLα strains

Author keywords

[No Author keywords available]

Indexed keywords

ALLELE; ARTICLE; CANDIDA ALBICANS; DIPLOIDY; DNA CONTENT; GENE LOCUS; MATING; NONHUMAN; PRIORITY JOURNAL; REPRODUCTION; STRAIN DIFFERENCE; TETRAPLOIDY;

EID: 0034647921     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.289.5477.310     Document Type: Article
Times cited : (367)

References (32)
  • 10
    • 0342913477 scopus 로고    scopus 로고
    • Sequences are made available by the Candida albicans Genome Sequencing Project at
    • Sequences are made available by the Candida albicans Genome Sequencing Project at www-sequence. stanford.edu/group/candida/.
  • 14
    • 0342479142 scopus 로고    scopus 로고
    • note
    • 32P by random priming.
  • 15
    • 0342479140 scopus 로고    scopus 로고
    • note
    • Media used were YEPD and Min (minimal medium) (7), PD (Difco), and YPB [YEPD plus the dye phloxin B (50 mg/liter)]. YPB and PD media probably induce mild stress, by starvation in the case of PD and by the presence of phloxin B in the case of YPB.
  • 16
    • 0343348663 scopus 로고    scopus 로고
    • note
    • imm434 insert were GGGGGATTATTGCAAATGCCACTGC (forward) and GAGCAAGTTCAGCCTGGTTAAGTCC (reverse).
  • 19
    • 0343348662 scopus 로고    scopus 로고
    • note
    • Several strains were streaked, each in a band about 1 cm wide, across a plate and allowed to grow for 36 hours. The plate was replicated onto a mating plate containing YEPD, YPB, or PD medium, A second plate, containing strains with complementing auxotrophic markers, was replicated in a perpendicular orientation onto the mating plate. The mating plates were incubated at room temperature except as noted in Fig. 2. After the period of time noted, the mating plates were replicated onto minimal medium and incubated for 3 days at 30°C.
  • 21
    • 0343348132 scopus 로고    scopus 로고
    • note
    • 7/ml) were fixed in 70% alcohol, washed with phosphate-buffered saline (PBS), treated with ribonuclease (1 mg/ml, 37°C, 75 min), and washed again with PBS. Cells were stained with propidium iodide (50 μg/ml) shortly before sorting (24, 25). FACS analysis was done on an Ortho Cytofluorograf lls (Diagnostic Systems) operated at 488 nm and 100 mW laser power. Propidium iodide fluorescence was collected with a 570 long-pass filter. Data were collected in list, area, and linear modes at rates of a few hundred cells per second with the Cicero Data acquisition system (Cytomation, Fort Collins, CO) (26).
  • 22
    • 0343348131 scopus 로고    scopus 로고
    • Information on attempts to induce meiosis and sporulation is available at Science Online at
    • Information on attempts to induce meiosis and sporulation is available at Science Online at www. sciencemag.org/feature.data/1049921.
  • 25
    • 0342912910 scopus 로고    scopus 로고
    • Additional examples of FACS analysis of recombinants are available on Science Online at
    • Additional examples of FACS analysis of recombinants are available on Science Online at www. sciencemag.org/feature.data/1049921.shl.
  • 31
    • 0343783821 scopus 로고    scopus 로고
    • note
    • The pulsed-field gel was run under conditions that emphasize the smaller chromosomes: 0.9% agarose, 0.5x tris-borate EDTA, 60-to 120-s switch, 6 V/cm, 120°C, 24 hours, 15°C, run on a CHEF DRIII (Biorad). Cells were grown on YEPD. Chromosomes were prepared as described (27).
  • 32
    • 0342912911 scopus 로고    scopus 로고
    • note
    • N. Abu-Absi and F. Srienc helped with the FACS analysis. S. Scherer, J. Beckerman, H. Chibana, and S. Grindle contributed helpful criticism, and J. Berman and S. Scherer provided comments on the manuscript C. Hull and A. Johnson generously provided the sequence of the MTLa allele and the organization of the MTL region before publication. We are very grateful to D. Gartner and the College of Biological Sciences Imaging Center (University of Minnesota) for help with the figures. Supported by grants AI16567, AI35109, and AI46351 from NIH (P.T.M.).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.