Genetic mechanisms of age regulation of human blood coagulation factor IX

Science

Volumn 285, Issue 5428, 1999, Pages 739-743

  Kurachi, Sumiko ^a   Deyashiki, Yoshihiro ^a   Takeshita, Junko ^a   Kurachi, Kotoku ^a  

^a UNIVERSITY OF MICHIGAN MEDICAL SCHOOL   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

BLOOD CLOTTING FACTOR 9; MESSENGER RNA;

ADOLESCENT; AGED; AGING; ARTICLE; BLOOD CLOTTING; CONTROLLED STUDY; GENE CONTROL; GENE EXPRESSION; GENE STRUCTURE; HUMAN; HUMAN CELL; MOUSE; NONHUMAN; PRIORITY JOURNAL; REGULATOR GENE; TRANSGENIC MOUSE;

3' UNTRANSLATED REGIONS; AGING; ANIMALS; CONSENSUS SEQUENCE; DINUCLEOTIDE REPEATS; DNA FOOTPRINTING; FACTOR IX; FEMALE; GENE EXPRESSION REGULATION; GENETIC VECTORS; HUMANS; MALE; MICE; MICE, TRANSGENIC; REGULATORY SEQUENCES, NUCLEIC ACID; RNA, MESSENGER; TRANSCRIPTION FACTORS; TRANSCRIPTION, GENETIC; TUMOR CELLS, CULTURED;

MUS MUSCULUS;

EID: 0033618499     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.285.5428.739     Document Type: Article

References (41)

1. S.-N. Yao, A. H. DeSilva, S. Kurachi, L. C. Samuelson, K. Kurachi, Thromb. Haemostasis 65, 52 (1991); M. Andrew et al., Blood 80, 1998 (1992); M. Andrew et al., ibid. 70, 165 (1987); M. Andrew et al., ibid. 72, 1651 (1988).
2. S.-N. Yao, A. H. DeSilva, S. Kurachi, L. C. Samuelson, K. Kurachi, Thromb. Haemostasis 65, 52 (1991); M. Andrew et al., Blood 80, 1998 (1992); M. Andrew et al., ibid. 70, 165 (1987); M. Andrew et al., ibid. 72, 1651 (1988).
3. S.-N. Yao, A. H. DeSilva, S. Kurachi, L. C. Samuelson, K. Kurachi, Thromb. Haemostasis 65, 52 (1991); M. Andrew et al., Blood 80, 1998 (1992); M. Andrew et al., ibid. 70, 165 (1987); M. Andrew et al., ibid. 72, 1651 (1988).
4. S.-N. Yao, A. H. DeSilva, S. Kurachi, L. C. Samuelson, K. Kurachi, Thromb. Haemostasis 65, 52 (1991); M. Andrew et al., Blood 80, 1998 (1992); M. Andrew et al., ibid. 70, 165 (1987); M. Andrew et al., ibid. 72, 1651 (1988).
5. J. D. Sweeney and L. A. Hoernig, Am. J. Clin. Pathol. 99, 687 (1993); S. Kurachi, E. Hitomi, K. Kurachi, Thromb. Haemostasis 76, 965 (1996).
6. J. D. Sweeney and L. A. Hoernig, Am. J. Clin. Pathol. 99, 687 (1993); S. Kurachi, E. Hitomi, K. Kurachi, Thromb. Haemostasis 76, 965 (1996).
7. D. Marie et al., Blood 85, 3144 (1995).
8. M. G. Conlan et al., The Atherosclerosis Risk in Communities (ARIC) Study 70, 380 (1993); L. Balleisen, J. Bailey, P.-H. Epping, H. Schulte, J. van de Loo, Thromb. Haemostasis 54, 475 (1985); J. J. Rode, A. H. Schulick, R. Vermani, D. A. Dichek, Nature Med. 2, 293 (1996); M. Woodward et al., Br. J. Haematol. 97, 785 (1997).
9. M. G. Conlan et al., The Atherosclerosis Risk in Communities (ARIC) Study 70, 380 (1993); L. Balleisen, J. Bailey, P.-H. Epping, H. Schulte, J. van de Loo, Thromb. Haemostasis 54, 475 (1985); J. J. Rode, A. H. Schulick, R. Vermani, D. A. Dichek, Nature Med. 2, 293 (1996); M. Woodward et al., Br. J. Haematol. 97, 785 (1997).
10. M. G. Conlan et al., The Atherosclerosis Risk in Communities (ARIC) Study 70, 380 (1993); L. Balleisen, J. Bailey, P.-H. Epping, H. Schulte, J. van de Loo, Thromb. Haemostasis 54, 475 (1985); J. J. Rode, A. H. Schulick, R. Vermani, D. A. Dichek, Nature Med. 2, 293 (1996); M. Woodward et al., Br. J. Haematol. 97, 785 (1997).
11. M. G. Conlan et al., The Atherosclerosis Risk in Communities (ARIC) Study 70, 380 (1993); L. Balleisen, J. Bailey, P.-H. Epping, H. Schulte, J. van de Loo, Thromb. Haemostasis 54, 475 (1985); J. J. Rode, A. H. Schulick, R. Vermani, D. A. Dichek, Nature Med. 2, 293 (1996); M. Woodward et al., Br. J. Haematol. 97, 785 (1997).
12. M. G. Conlan et al., The Atherosclerosis Risk in Committees (ARIC) Study 72, 551 (1994); G. D. O. Lowe et al., Br. J. Haematol. 97, 775 (1997).
13. M. G. Conlan et al., The Atherosclerosis Risk in Committees (ARIC) Study 72, 551 (1994); G. D. O. Lowe et al., Br. J. Haematol. 97, 775 (1997).
14. H. Saito, in Disorders of Hemostasis, O. D. Ratnoff and C. D. Forbes, Eds. (Saunders, Philadelphia, PA, ed. 2, 1991), pp. 18-47; K. Kurachi, S. Kurachi, M. Furukawa, S.-N. Yao, Blood Coagul. Fibrinol. 4, 953 (1993).
15. H. Saito, in Disorders of Hemostasis, O. D. Ratnoff and C. D. Forbes, Eds. (Saunders, Philadelphia, PA, ed. 2, 1991), pp. 18-47; K. Kurachi, S. Kurachi, M. Furukawa, S.-N. Yao, Blood Coagul. Fibrinol. 4, 953 (1993).
16. Construction of hFIX minigene expression vectors was carried out with -416FIXm1 as the starting construct (19). The nt numbering system used in this study was based on the complete hFIX gene sequence, as we previously reported (9). Minigene -416FIXm1/1.4 was constructed from -416FIXm1 by inserting the middle portion of the 3′ UTR (12 kb in size), which was generated by polymerase chain reaction (PCR) using 5′ and 3′ primers with Bam HI linker, TAACAGGATCCGGCCTCTCACTAACTAATCAC (nt +31418 through +31438), and CAACTGGATCCAAGATTCAAGATAGAAGGAT (nt +32690 through +32671), respectively, and human genomic DNA as the template. The Bam HI fragment obtained by digestion of the PCR product was inserted into the 3′ UTR Bam HI site of -416FIXm1, thus producing -416FIXm1/1.4, which contained the entire 3′ UTR. -416FIXm1/0.7 was constructed by inserting the PCR-amplified 700-bp fragment with Bam HI linker, containing the 3′ contiguous sequence to nt +32117. Minigenes -590FIXm1, -679FIXm1, -770FIXm1, -802FIXm1, and -2231FIXm1 were produced by replacing the 5′ end 433-bp sequence of -416FIXm1 released by Sph I-Nhe I digestion with 607-, 696-, 787-, 819-, and 2248-bp fragments containing the 5′ end hFIX region extended up to nt -590, -679, -770, -802, and -2231, respectively. -416FIX m1/AE5′ was constructed by inserting the Kpn I fragment generated by PCR (nt -802 through nt -417) into the -416FIXm1 vector [the Kpn I site is outside of the FIX gene (Fig. 1)]. The 5′ and 3′ primers used for PCR were CTTGGTACCAGCCATTCAGTCGAGGAAGG (nt -802 through -783) and CTTGGTACCATATGAATCCTTTCATAGAT (nt -417 through -436), respectively. All constructs were sequenced through PCR-amplified regions as well as fragment ligation sites to confirm correct sequences and orientations. Transient in vitro expression activities of hFIX minigene constructs were assayed using HepG2 cells and an hFIX-specific enzyme-linked immunosorbent assay (ELISA) as previously described (79) with some modifications. Cell transfection was carried out by the calcium phosphate-DNA conjugate method or, later, by the use of FuGene 6 (Boehringer-Mannheim). The latter improved transfection method consistently increased transfection efficiency to >20% [S. Kurachi, L. Sze, K. Kurachi, Biochemica 3, 43 (1998)]. and all earlier assays were reexamined with FuGene 6. Four to five independent assays were carried out, and the averages were shown with standard deviations.
17. In the HepG2 cell assay system, these hFIX minigenes do not show any down-regulation in the presence of the 5′ upstream region (nt -802 up through nt -1900) (Fig. 1). In contrast, when a CAT reporter gene was used, negative regulatory elements were identified in this region (20). The use of a heterologous reporter gene to analyze unrelated genes may produce irrelevant results that are greatly skewed from natural gene regulation, presumably due to the absence of critical structural elements in the heterologous reporter gene that are needed for regulation of the native genes in concert with their own 5′ promoters. Alternatively, structural elements in the heterologous genes may also affect the transcriptional regulation of the genes being studied, thus producing irrelevant results.
18. S. Yoshitake, B. G. Schach, D. C. Foster, E. W. Davie, K. Kurachi, Biochemistry 24, 3736 (1985).
19. J. Ross, Microbiol. Rev. 59, 423 (1995).
20. 32P-labeled Ssp I-Bam HI fragment (the 3′ half of the hFIX coding region -416FIXm1) as a probe and employing stringent washing conditions to eliminate probe hybridization to the mFIX mRNA. To confirm the presence of equivalent amounts of RNA in each lane, the filters were reprobed with the RNR18 cDNA (ribosomal RNA 185). All animal experiments were carried out in accordance with the institutional guidelines of the University of Michigan (Office for Protection from Research Risks no. A3114-01).
21. Liver expression of hFIX observed for minigenes without AE5′ (-770FIXm1 remains to be tested) was high but not as robust as that seen with the natural hFIX gene; expression in other tissues, such as kidney, lung, and muscle, was as high as ∼20% of the liver level. In contrast, -802FIXm1 showed virtually complete liver-specific hFIX expression, similar to that for the natural FIX gene (S. Kurachi and K. Kurachi, data not shown).
22. M. E. Martin, J. Pientte, M. Yaniv, W.-J. Tang, W. R. Folk, Proc. Natl. Acad. Sci. U.S.A. 85, 5839 (1988); J.-H. Xin, A. Cowie, P. Lachance, J. A. Hassell, Genes Dev. 6, 481 (1992); A. Chotteau-Lelievre, X. Desbiens, H. Pelczar, P.-A. Defossez, Y. de Launoit, Oncogene 15, 937 (1997); A. Gutman and B. Wasylyk, EMBO J. 9, 2241 (1990).
23. M. E. Martin, J. Pientte, M. Yaniv, W.-J. Tang, W. R. Folk, Proc. Natl. Acad. Sci. U.S.A. 85, 5839 (1988); J.-H. Xin, A. Cowie, P. Lachance, J. A. Hassell, Genes Dev. 6, 481 (1992); A. Chotteau-Lelievre, X. Desbiens, H. Pelczar, P.-A. Defossez, Y. de Launoit, Oncogene 15, 937 (1997); A. Gutman and B. Wasylyk, EMBO J. 9, 2241 (1990).
24. M. E. Martin, J. Pientte, M. Yaniv, W.-J. Tang, W. R. Folk, Proc. Natl. Acad. Sci. U.S.A. 85, 5839 (1988); J.-H. Xin, A. Cowie, P. Lachance, J. A. Hassell, Genes Dev. 6, 481 (1992); A. Chotteau-Lelievre, X. Desbiens, H. Pelczar, P.-A. Defossez, Y. de Launoit, Oncogene 15, 937 (1997); A. Gutman and B. Wasylyk, EMBO J. 9, 2241 (1990).
25. M. E. Martin, J. Pientte, M. Yaniv, W.-J. Tang, W. R. Folk, Proc. Natl. Acad. Sci. U.S.A. 85, 5839 (1988); J.-H. Xin, A. Cowie, P. Lachance, J. A. Hassell, Genes Dev. 6, 481 (1992); A. Chotteau-Lelievre, X. Desbiens, H. Pelczar, P.-A. Defossez, Y. de Launoit, Oncogene 15, 937 (1997); A. Gutman and B. Wasylyk, EMBO J. 9, 2241 (1990).
26. F. D. Karim et al., Genes Dev. 4, 1451 (1990); B. Nelsen et al., Science 261, 82 (1993); R. J. Fisher, G. Mavrothalassitis, A. Kondoh, T. S. Papas, Oncogene 6, 2249 (1991).
27. F. D. Karim et al., Genes Dev. 4, 1451 (1990); B. Nelsen et al., Science 261, 82 (1993); R. J. Fisher, G. Mavrothalassitis, A. Kondoh, T. S. Papas, Oncogene 6, 2249 (1991).
28. F. D. Karim et al., Genes Dev. 4, 1451 (1990); B. Nelsen et al., Science 261, 82 (1993); R. J. Fisher, G. Mavrothalassitis, A. Kondoh, T. S. Papas, Oncogene 6, 2249 (1991).
29. H. H. Kazazian Jr. et al., Nature 332, 164 (1988); B. A. Dombroski, A. F. Scott, H. H. Kazazian Jr., Proc. Natl. Acad. Sci. U.S.A. 90, 6513 (1993); R. Minakami et al., Nucleic Acids Res. 20, 3139 (1992); B. A. Dombroski et al., Mol. Cell. Biol. 14, 4485 (1994).
30. H. H. Kazazian Jr. et al., Nature 332, 164 (1988); B. A. Dombroski, A. F. Scott, H. H. Kazazian Jr., Proc. Natl. Acad. Sci. U.S.A. 90, 6513 (1993); R. Minakami et al., Nucleic Acids Res. 20, 3139 (1992); B. A. Dombroski et al., Mol. Cell. Biol. 14, 4485 (1994).
31. H. H. Kazazian Jr. et al., Nature 332, 164 (1988); B. A. Dombroski, A. F. Scott, H. H. Kazazian Jr., Proc. Natl. Acad. Sci. U.S.A. 90, 6513 (1993); R. Minakami et al., Nucleic Acids Res. 20, 3139 (1992); B. A. Dombroski et al., Mol. Cell. Biol. 14, 4485 (1994).
32. H. H. Kazazian Jr. et al., Nature 332, 164 (1988); B. A. Dombroski, A. F. Scott, H. H. Kazazian Jr., Proc. Natl. Acad. Sci. U.S.A. 90, 6513 (1993); R. Minakami et al., Nucleic Acids Res. 20, 3139 (1992); B. A. Dombroski et al., Mol. Cell. Biol. 14, 4485 (1994).
33. W. Hsu, S. Kawarura, S. Kurachi, K. Kurachi, in preparation.
34. The effects of age on hFIX clearance from the circulation were tested as follows. Aliquots of plasma-derived hFIX preparation (Haematologic Technologies, Sussex Junction, VT; 5 μg per 0.1 ml of phosphate-buffered saline) were injected via tail vein into normal animals at 2, 9 to 10, and 19 to 23 months of age (n = 3 per age group), which had the same genetic background as the transgenic mice (C57BL/6 × SJL). The hFIX level in circulation was monitored by ELISA of collected blood samples (∼50-μl aliquots) at 10 min and 2, 6, 12, 18, 24, 30, 36, and 48 hours after protein injection. As expected, all animals of different age groups showed typical biphasic clearance kinetics (two-compartment distribution and clearance) with a initial rapid clearance phase (α phase), followed by a slower clearance phase (β phase). Half-clearance times (17.8 hours) observed for 2-month-old BALB/c mice were very similar to those observed for CS7BL/6 mice.
35. Both males and females with sustained high hFIX levels in circulation (approximately 1500 ng/ml or higher) tended to die at a much earlier age than their expected lifespan (∼2 years) (Fig. 3, A, B, and D). These transgenic mice had hFIX in addition to their own mFIX, suggesting the possibility of lethal thrombosis in these animals.
36. S. Kurachi, Y. Hitomi, M. Furukawa, K. Kurachi, J. Biol. Chem. 270, 5276 (1995).
37. J.-P. Salier, S. Hirosawa, K. Kurachi, J. Biol. Chem. 265, 7062 (1990).
38. B. Hogan, F. Costantini, E. Lacy, in Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, ed. 2, 1994).
39. D. A. Konkel, S. M. Tilghman, P. Leder, Cell 15, 1125 (1978).
40. S. Kurachi et al., Biochemistry 33, 1580 (1994).
41. Supported in part by NIH grants HL38644 and HL53713, the University of Michigan Nathan Shock Center for the Basic Biology of Aging Award (NIA grant AG13283), the Pepper Center for Aging Research Award (AG08808), the Multipurpose Arthritis and Musculoskeletal Disease Center (grant NIH-5-P60-AR20557), and the General Clinical Research Center (grant MO1-RR00042). We thank R. Miller for encouragement and reading the manuscript J. Huo for assistance in preparing the manuscript R. Rosenberg and K. Ravit for their initial introduction to transgenk mice experiments, and T. Saunders and M. Berard at the Biomedical Research Animal Model Core facility for their technical help.