Isolation of West Nile virus from mosquitoes, crows, and a Cooper's hawk in Connecticut

Science

Volumn 286, Issue 5448, 1999, Pages 2331-2333

  Anderson, John F ^a   Andreadis, Theodore G ^a   Vossbrinck, Charles R ^a   Tirrell, Shirley ^b   Wakem, Edward M ^c   French, Richard A ^c   Garmendia, Antonio E ^c   Van Kruiningen, Herbert J ^c  

^a Connecticut Agric Exp Station ^*  (United States)

^b YALE UNIVERSITY SCHOOL OF MEDICINE   (United States)

^c UNIVERSITY OF CONNECTICUT   (United States)

Author keywords

[No Author keywords available]

Indexed keywords

AEDES; ANIMAL TISSUE; ARTICLE; BIRD; CULEX PIPIENS; GENE SEQUENCE; NONHUMAN; NUCLEOTIDE SEQUENCE; PHYLOGENY; PRIORITY JOURNAL; VIRUS ISOLATION; WEST NILE FLAVIVIRUS;

AEDES; ANIMALS; BASE SEQUENCE; BIRD DISEASES; BRAIN; CONNECTICUT; CULEX; CULICIDAE; GENOME, VIRAL; HUMANS; INSECT VECTORS; PHYLOGENY; RAPTORS; ROMANIA; SONGBIRDS; WEST NILE FEVER; WEST NILE VIRUS;

ACCIPITER COOPERII; ACCIPITRINAE; AEDES VEXANS; ANIMALIA; AVES; CORVIDAE; CORVUS BRACHYRHYNCHOS; CULEX PIPIENS; FLAVIVIRUS; WEST NILE VIRUS;

EID: 0033579329     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.286.5448.2331     Document Type: Article

References (25)

1. D. Asnis et al., Morbid. Mortal. Wkly. Rep. 48, 845 (1999).
2. T. Briese et al., Lancet 354, 1261 (1999).
3. 2. Cells were examined for cytopathologic effect for up to 7 days after inoculation.
4. C. G. Sibley and B. L. Monroe Jr., Distribution and Taxonomy of Birds of the World (Yale Univ. Press, New Haven, CT, 1990). Common and scientific names of birds are used in accordance with those listed in this book.
5. Total numbers of mosquitoes by species that were collected in 14 towns in Fairfield County, CT, and tested for virus from 6 September through 14 October 1999: Ae. vexans, 1688; Ae. cinereus, 172; Ae. trivittatus, 131; Ae. taeniorhynchus, 123; Ae. sollicitant, 109; Ae. cantator, 63; Ae. triseriatus, 28; Ae. japonicus, 19; Ae. canadensis, 1; Anopheles punctipennis, 82; An. quadrimaculatus, 4; An. walkeri, 2; Coquillettidia perturbans, 15; Culex pipiens. 744; Cx. restuans, 27; Cx. erraticus, 4; Cx. territans, 1; Culiseta melanura, 76; Cs. morsitans, 1; Psorophora ferox, 4; and Uranotaenia sapphirina, 104.
6. M. Z. Ansari, R. E. Shope, S. Malik, J. Clin. Lab. Anal. 7, 230 (1993). Isolates were tested initially in an ELISA against reference antibodies to six viruses, in three families, isolated from mosquitoes in North America. The antibodies were prepared in mice and provided by the World Health Organization Center for Arbovirus Research and Reference, Yale Arbovirus Research Unit, Department of Epidemiology and Public Health, Yale University School of Medicine. The antibodies were to Eastern Equine Encephalomyelitis, Highlands J, Cache Valley, LaCrosse, Jamestown Canyon, and St. Louis Encephalitis viruses.
7. Most dead birds were collected by state or town personnel in Connecticut and sent to the Pathobiology Department at the University of Connecticut, Storrs, where they were examined for postmortem and nutritional condition, gross lesions, and microscopic evidence indicative of encephalitis. Brain tissue from birds with presumed encephalitis were frozen at -70°C and then sent to the Connecticut Agricultural Experiment Station, New Haven, for virus testing. Corresponding brain sections were processed for histologic examination. A 10% suspension of each sampled brain tissue was prepared in 1.5 ml of phosphate-buffered saline by triturating with a mortar and pestle (3). Two to seven tissue samples from each brain were tested for virus. Alundum was added to facilitate homogenization of tissue. Suspensions were centrifuged at 520g for 10 min. The supernatant of each sample was then passed through a 0.22-μm filter before inoculation of a 100-μl sample onto a monolayer of Vero cells. Cells were grown and examined for cytopathologic effect (3). Isolates were initially tested against reference antibodies (6). 8. Connecticut towns from which dead crows were collected and virus isolated from brain tissues (number of isolates in parentheses): Bridgeport (n = 1), Darien (n = 1), Fairfield (n = 4), Greenwich (n = 3), Hamden (n = 1), Madison (n = 1), Milford (n = 1). New Canaan (n = 1), New Haven (n = 3), North Haven (n = 1), Norwalk (n = 1), Redding (n = 1). Stamford (n = 5), Stratford (n = 1), Weston (n = 1), Westport (n = 1), and Woodbridge (n = 1).
8. The Cooper's hawk was observed alive on the ground on 25 September 1999 and was described as having difficulty standing, spinning in circles, and having seizures. It died 11 hours after being found. Gross pathology of the brain showed extensive hemorrhage.
9. D. L. Swofford, PAUP: Phylogenetic Analysis Using Parsimony Users Manual (Illinois Natural History Survey, Champaign, 1993). Data were analyzed by PAUP 4b.1 with maximum parsimony, maximum likelihood, and neighbor-joining analysis. The data set was identical for all analyses. A total of 933 characters was used, including insertions created during (Clustal X ) alignment All characters were unordered and had equal weight; all sites were assumed to evolve at the same rate. Four hundred and forty-six characters were constant, 281 characters were parsimony-uninformative, and 206 characters were parsimony-informative. Gaps were treated as missing. For maximum parsimony analysis, the best tree found = 754; number of trees retained = 1. The branch and bound method of search was used to guarantee finding the shortest tree (or trees). For the bootstrap analysis, 500 replicates were run with the maximum parsimony method. Maximum likelihood analysis settings corresponded to the Felsenstein model. Transition/transversion ratio = 2 (κ = 3.88125); molecular clock was not enforced; trees with approximate likelihoods of 5% or further from the target score were rejected without additional iteration; "MulTrees" option was in effect; topological constraints were not enforced. Score for best tree found by maximum likelihood analysis = 4278.24084; number of trees retained = 1. Trees were run as unrooted. Passage 2 of each virus isolate was grown in Vero cells (3) at 37°C. Infected cells were scraped from the bottom of the flask, centrifuged at 4500g for 10 min, and the supernatant was discarded. RNA was extracted from the pellet using the Rneasy mini protocol (Qiagen), eluting the column twice with 40 μl of ribonuclease-free water. Two microliters of each eluate were used in a 50-μl reverse transcription-polymerase chain reaction (RT-PCR) with the GeneAmp EZ rTth RNA PCR kit (Perkin-Elmer). Primers WN-233F- GACTGAAGAGGGAATGTTGAGC and WN-1189R- GCAATAACTGCGGACYTCTGC used in the reaction were designed to specifically amplify WN and Kunjin viruses based on an alignment of six flavivirus isolates listed in GenBank [SLE virus capsid, membrane, envelope: accession M16614; Japanese encephalitis virus polyprotein: accession M73710; Kunjin virus gene for polyprotein: accession D00246; Nigerian WN virus complete genome: accession M12294; Romania WN virus strain R097-50 polyprotein gene, partial, accession AF130362; Romania WN virus strain 96-1030 polyprotein gene, accession AF130363]. PCR products were purified with the QIAquick PCR Purification Kit (Qiagen) and submitted to the Keck Biotechnology Center at Yale University, New Haven, CT, for sequencing. Sequences were aligned with Clustalx 1.64B [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)].
10. D. L. Swofford, PAUP: Phylogenetic Analysis Using Parsimony Users Manual (Illinois Natural History Survey, Champaign, 1993). Data were analyzed by PAUP 4b.1 with maximum parsimony, maximum likelihood, and neighbor-joining analysis. The data set was identical for all analyses. A total of 933 characters was used, including insertions created during (Clustal X ) alignment All characters were unordered and had equal weight; all sites were assumed to evolve at the same rate. Four hundred and forty-six characters were constant, 281 characters were parsimony-uninformative, and 206 characters were parsimony-informative. Gaps were treated as missing. For maximum parsimony analysis, the best tree found = 754; number of trees retained = 1. The branch and bound method of search was used to guarantee finding the shortest tree (or trees). For the bootstrap analysis, 500 replicates were run with the maximum parsimony method. Maximum likelihood analysis settings corresponded to the Felsenstein model. Transition/transversion ratio = 2 (κ = 3.88125); molecular clock was not enforced; trees with approximate likelihoods of 5% or further from the target score were rejected without additional iteration; "MulTrees" option was in effect; topological constraints were not enforced. Score for best tree found by maximum likelihood analysis = 4278.24084; number of trees retained = 1. Trees were run as unrooted. Passage 2 of each virus isolate was grown in Vero cells (3) at 37°C. Infected cells were scraped from the bottom of the flask, centrifuged at 4500g for 10 min, and the supernatant was discarded. RNA was extracted from the pellet using the Rneasy mini protocol (Qiagen), eluting the column twice with 40 μl of ribonuclease-free water. Two microliters of each eluate were used in a 50-μl reverse transcription-polymerase chain reaction (RT-PCR) with the GeneAmp EZ rTth RNA PCR kit (Perkin-Elmer). Primers WN-233F-GACTGAAGAGGGAATGTTGAGC and WN-1189R-GCAATAACTGCGGACYTCTGC used in the reaction were designed to specifically amplify WN and Kunjin viruses based on an alignment of six flavivirus isolates listed in GenBank [SLE virus capsid, membrane, envelope: accession M16614; Japanese encephalitis virus polyprotein: accession M73710; Kunjin virus gene for polyprotein: accession D00246; Nigerian WN virus complete genome: accession M12294; Romania WN virus strain R097-50 polyprotein gene, partial, accession AF130362; Romania WN virus strain 96-1030 polyprotein gene, accession AF130363]. PCR products were purified with the QIAquick PCR Purification Kit (Qiagen) and submitted to the Keck Biotechnology Center at Yale University, New Haven, CT, for sequencing. Sequences were aligned with Clustalx 1.64B [J. D. Thompson, D. G. Higgins, T. J. Gibson, Nucleic Acids Res. 22, 4673 (1994)].
11. Supplemental web material is available at www. sciencemag.org/feature/data/1046471.shl.
12. T. F. Tsai et al., Lancet 352, 767 (1998); H. M. Savage et al., Am. J. Trop Med. Hyg. 61, 600 (1999).
13. T. F. Tsai et al., Lancet 352, 767 (1998); H. M. Savage et al., Am. J. Trop Med. Hyg. 61, 600 (1999).
14. F.-X. Berthet et al., J. Gen. Virol. 78, 2293 (1997).
15. K. C. Smithburn et al., Am. J. Trop. Med. 20, 471 (1940).
16. C. C. Hayes, in The Arboviruses: Epidemiology and Ecology, T. P. Monath, Ed. (CRC, Boca Raton, FL, 1989), vol. 5. chap. 49.
17. Z. Hubalek and J. Halouzka, Emerg. Infect. Dis. 5, 643 (1999).
18. C. B. Philip and J. E. Smadel, Proc. Soc. Exp. Biol. Med. 53, 49 (1943).
19. R. M. Taylor et al., Am. J. Trop. Med. Hyg, 5, 579 (1956).
20. M. Kitaoka, Jap. Med. J. 3, 77 (1950).
21. T. H. Work, H. S. Hurlbut, R. M. Taylor, Am. J. Trop. Med. Hyg. 4, 872 (1955).
22. _, Proc. Soc. Exp. Biol. Med. 84, 719 (1953).
23. 4, dehydrated through an ethanol and acetone series, and embedded in an LX-112-Araldite mixture. Thin sections were poststained with 5% (w/v) uranyl acetate in 50% (v/v) methanol followed by Reynold's lead citrate and examined in a Zeiss EM 10C electron microscope at an accelerating voltage of 80 kV. Virus particles measured 35 to 40 nm.
24. R. S. Lanciotti et al., Science 286, 2333 (1999).
25. We thank J. Correia, J. Shepard, M. Vasil, B. Hamid, C. Scott, and T. Blevins for technical assistance. P. Mazik, P. Mazik, R. Wagner, P. Lucas, T. Capanella, R. Nieves, and S. Nieves helped with the collection of mosquitoes in Greenwich and Stamford. K. Hannon and R. Schaper provided the brain from the Cooper's hawk. Supported in part by Hatch Grant 763 and NIH grant P01-AI-30548.