메뉴 건너뛰기




Volumn 285, Issue 5426, 1999, Pages 406-409

Bacterial photoreceptor with similarity to photoactive yellow protein and plant phytochromes

Author keywords

[No Author keywords available]

Indexed keywords

BACTERIAL DNA; BACTERIAL PROTEIN; CHALCONE SYNTHASE; PARA COUMARIC ACID; PHYTOCHROME; PLANT DNA; PROTEIN PRP; UNCLASSIFIED DRUG;

EID: 0033575370     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.285.5426.406     Document Type: Article
Times cited : (164)

References (39)
  • 2
    • 0029818880 scopus 로고    scopus 로고
    • D. M. Kehoe and A. R. Grossman, Science 273, 1409 (1996); K.-C. Yen, S.-H. Wu, J. T. Murphy, J. C. Lagarias, ibid. 277, 1505 (1997); J. Hughes el al., Nature 386, 663 (1997); T. D. Elich and J. Chory, Cell 91, 713 (1997).
    • (1996) Science , vol.273 , pp. 1409
    • Kehoe, D.M.1    Grossman, A.R.2
  • 3
    • 0029818880 scopus 로고    scopus 로고
    • D. M. Kehoe and A. R. Grossman, Science 273, 1409 (1996); K.-C. Yen, S.-H. Wu, J. T. Murphy, J. C. Lagarias, ibid. 277, 1505 (1997); J. Hughes el al., Nature 386, 663 (1997); T. D. Elich and J. Chory, Cell 91, 713 (1997).
    • (1997) Science , vol.277 , pp. 1505
    • Yen, K.-C.1    Wu, S.-H.2    Murphy, J.T.3    Lagarias, J.C.4
  • 4
    • 0031575895 scopus 로고    scopus 로고
    • D. M. Kehoe and A. R. Grossman, Science 273, 1409 (1996); K.-C. Yen, S.-H. Wu, J. T. Murphy, J. C. Lagarias, ibid. 277, 1505 (1997); J. Hughes el al., Nature 386, 663 (1997); T. D. Elich and J. Chory, Cell 91, 713 (1997).
    • (1997) Nature , vol.386 , pp. 663
    • Hughes, J.1
  • 5
    • 0031454154 scopus 로고    scopus 로고
    • D. M. Kehoe and A. R. Grossman, Science 273, 1409 (1996); K.-C. Yen, S.-H. Wu, J. T. Murphy, J. C. Lagarias, ibid. 277, 1505 (1997); J. Hughes el al., Nature 386, 663 (1997); T. D. Elich and J. Chory, Cell 91, 713 (1997).
    • (1997) Cell , vol.91 , pp. 713
    • Elich, T.D.1    Chory, J.2
  • 8
    • 0027493250 scopus 로고
    • M. Ahmad and A. R. Cashmore, Nature 366, 162 (1993); C. Lin et al., Proc. Natl. Acad. Sci. U.S.A. 95, 2686 (1998).
    • (1993) Nature , vol.366 , pp. 162
    • Ahmad, M.1    Cashmore, A.R.2
  • 9
    • 0032478076 scopus 로고    scopus 로고
    • M. Ahmad and A. R. Cashmore, Nature 366, 162 (1993); C. Lin et al., Proc. Natl. Acad. Sci. U.S.A. 95, 2686 (1998).
    • (1998) Proc. Natl. Acad. Sci. U.S.A. , vol.95 , pp. 2686
    • Lin, C.1
  • 10
  • 12
    • 0030035662 scopus 로고    scopus 로고
    • T. E. Meyer, Biochim. Biophys. Acta 806, 175 (1985); R. Kort et al., EMBO J. 15, 3209 (1996).
    • (1996) EMBO J. , vol.15 , pp. 3209
    • Kort, R.1
  • 15
    • 0029110488 scopus 로고
    • C. E. O. Borgstahl, D. R. Williams, E. D. Getzoff, ibid. 34, 6278 (1995); P. Dux et al., ibid. 37, 12689 (1998); U. K. Genick, S. M. Soltis, P. Kuhn, I. L. Canestrelli, E. D. Getzoff, Nature 392, 206 (1998); T. E. Meyer, G. Tollin, M. A. Cusanovich, Science 281, 1964 (1998).
    • (1995) Biochemistry , vol.34 , pp. 6278
    • Borgstahl, C.E.O.1    Williams, D.R.2    Getzoff, E.D.3
  • 16
    • 0037596438 scopus 로고    scopus 로고
    • C. E. O. Borgstahl, D. R. Williams, E. D. Getzoff, ibid. 34, 6278 (1995); P. Dux et al., ibid. 37, 12689 (1998); U. K. Genick, S. M. Soltis, P. Kuhn, I. L. Canestrelli, E. D. Getzoff, Nature 392, 206 (1998); T. E. Meyer, G. Tollin, M. A. Cusanovich, Science 281, 1964 (1998).
    • (1998) Biochemistry , vol.37 , pp. 12689
    • Dux, P.1
  • 17
    • 0032510475 scopus 로고    scopus 로고
    • C. E. O. Borgstahl, D. R. Williams, E. D. Getzoff, ibid. 34, 6278 (1995); P. Dux et al., ibid. 37, 12689 (1998); U. K. Genick, S. M. Soltis, P. Kuhn, I. L. Canestrelli, E. D. Getzoff, Nature 392, 206 (1998); T. E. Meyer, G. Tollin, M. A. Cusanovich, Science 281, 1964 (1998).
    • (1998) Nature , vol.392 , pp. 206
    • Genick, U.K.1    Soltis, S.M.2    Kuhn, P.3    Canestrelli, I.L.4    Getzoff, E.D.5
  • 18
    • 0032566792 scopus 로고    scopus 로고
    • C. E. O. Borgstahl, D. R. Williams, E. D. Getzoff, ibid. 34, 6278 (1995); P. Dux et al., ibid. 37, 12689 (1998); U. K. Genick, S. M. Soltis, P. Kuhn, I. L. Canestrelli, E. D. Getzoff, Nature 392, 206 (1998); T. E. Meyer, G. Tollin, M. A. Cusanovich, Science 281, 1964 (1998).
    • (1998) Science , vol.281 , pp. 1964
    • Meyer, T.E.1    Tollin, G.2    Cusanovich, M.A.3
  • 21
    • 0028245793 scopus 로고
    • L. Ragatz, Z. Y. Jiang, C. E. Bauer, H. Gest, Nature 370, 104 (1994); Arch. Microbiol. 163, 1 (1995).
    • (1995) Arch. Microbiol. , vol.163 , pp. 1
  • 22
    • 0344335033 scopus 로고    scopus 로고
    • note
    • PYP-phytochrome was amplified by PCR with oligonucleotides GTSATCGGNAAGAACTTCTTY and ACSCGYTTSACGAANANCCA. The entire gene was cloned from a genomic library, sequenced, and deposited in GenBank database under accession number AF064527.
  • 24
    • 0031127716 scopus 로고    scopus 로고
    • 2,0.1 mM EDTA, and 50% glycerol p-Hydroxycinnamic acid was attached as described [S. Devanathan et al., Arch. Biochem. Biophys. 340, 83 (1997)].
    • (1997) Arch. Biochem. Biophys. , vol.340 , pp. 83
    • Devanathan, S.1
  • 25
    • 0024730905 scopus 로고
    • T. E. Meyer, G. Tollin, J. H. Hazzard, M. A. Cusanovich, Biophys. J. 56, 559 (1989); T. E. Meyer, G. Tollin, T. P. Causgrove, P. Cheng, R. E. Blankenship, ibid. 59, 988 (1991); L. Ujj et al., Biophys. J. 75, 406 (1998).
    • (1989) Biophys. J. , vol.56 , pp. 559
    • Meyer, T.E.1    Tollin, G.2    Hazzard, J.H.3    Cusanovich, M.A.4
  • 27
    • 0031808072 scopus 로고    scopus 로고
    • T. E. Meyer, G. Tollin, J. H. Hazzard, M. A. Cusanovich, Biophys. J. 56, 559 (1989); T. E. Meyer, G. Tollin, T. P. Causgrove, P. Cheng, R. E. Blankenship, ibid. 59, 988 (1991); L. Ujj et al., Biophys. J. 75, 406 (1998).
    • (1998) Biophys. J. , vol.75 , pp. 406
    • Ujj, L.1
  • 28
    • 0344335032 scopus 로고    scopus 로고
    • note
    • 32P-Labeled protein bands were quantified by Phosphorlmager analysis (Molecular Dynamics, Sunnyvale, CA).
  • 30
    • 0344767069 scopus 로고    scopus 로고
    • note
    • -1, so the maximum ratio of absorption of Ppr at 434 nm to that at 280 nm is 0.442. The ratio of absorption of reconstituted Ppr at 434 nm to that at 280 nm was 0.29, giving a ∼60% efficiency of attachment (7).
  • 31
    • 0345629578 scopus 로고    scopus 로고
    • note
    • ppr amino acid residues 114 to 750 were replaced with a spectinomycin resistance gene in the suicide vector pGmLacZ. After delivery by conjugation (27), double recombinants were selected and confirmed by PCR analysis.
  • 34
    • 0344335030 scopus 로고    scopus 로고
    • GenBank Accession number AF121274
    • GenBank Accession number AF121274.
  • 35
    • 0345629575 scopus 로고    scopus 로고
    • note
    • The K. centenum chs promoter was amplified by PCR with primers TACGTACCGATGAACACCCAGCCCAC and TAGCATGCCGTGAAAACGGGGGAGAG. The PCR product was cloned into the lacZ reporter plasmid pZJD11 (21) and maintained with antibiotics.
  • 36
    • 0345197521 scopus 로고    scopus 로고
    • note
    • R. centenum was cultured in peptone-yeast extractsoytone (12) and illuminated with infrared light (>700 nm). White light was provided with a 400-W pressure sodium Lumalux lamp (LU400, Osram Sylvania, Danvers, MA) and blue light (400 to 450 nm) by passing the white light through filters. Cells were assayed for β-Gal activity as described (21).
  • 37
    • 0344767065 scopus 로고    scopus 로고
    • Supplemental Web material is available at www. sciencemag.org/feature/data/1039035.shl.
  • 39
    • 0344335027 scopus 로고    scopus 로고
    • note
    • We thank T. Meyer and R. Hangarter for comments. Supported by NIH grant GM 40941 (C.E.B.) and a NSF postdoctoral fellowship (B.G.R.).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.