Mammalian transgenesis by intracytoplasmic sperm injection

Science

Volumn 284, Issue 5417, 1999, Pages 1180-1183

  Perry, Anthony C F ^a   Wakayama, Teruhiko ^a   Kishikawa, Hidefumi ^a   Kasai, Tsuyoshi ^a   Okabe, Masaru ^b   Toyoda, Yutaka ^c   Yanagimachi, Ryuzo ^a  

^a UNIVERSITY OF HAWAII   (United States)

^b OSAKA UNIVERSITY   (Japan)

^c OBIHIRO UNIVERSITY OF AGRICULTURE AND VETERINARY MEDICINE   (Japan)

Author keywords

[No Author keywords available]

Indexed keywords

ANIMAL CELL; ARTICLE; EMBRYO DEVELOPMENT; FERTILIZATION IN VITRO; GENE EXPRESSION; GENETIC ENGINEERING; GENETIC RECOMBINATION; GENETIC TRANSFECTION; INTRACYTOPLASMIC SPERM INJECTION; MOUSE; NONHUMAN; PRIORITY JOURNAL; TRANSGENE;

ANIMALS; BLASTOCYST; CELL MEMBRANE; CULTURE TECHNIQUES; EMBRYO TRANSFER; EMBRYONIC AND FETAL DEVELOPMENT; FEMALE; FERTILIZATION IN VITRO; GENE TRANSFER TECHNIQUES; GENES, REPORTER; GREEN FLUORESCENT PROTEINS; LAC OPERON; LUMINESCENT PROTEINS; MALE; MICE; MICE, TRANSGENIC; MICROINJECTIONS; MORULA; OOCYTES; SPERM HEAD; TRANSGENES;

ANIMALIA; MAMMALIA;

EID: 0033553592     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.284.5417.1180     Document Type: Article

References (42)

1. J. W. Gordon, G. A. Scangos, D. J. Plotkin, J. A. Barbosa, F. H. Ruddle, Proc. Natl. Acad. Sci. U.S.A. 77, 7380 (1980); J. W. Gordon and F. H. Ruddle, Science 214, 1244 (1981); R. D. Palmiter and R. L. Brinster, Annu. Rev. Genet. 20, 465 (1986).
2. J. W. Gordon, G. A. Scangos, D. J. Plotkin, J. A. Barbosa, F. H. Ruddle, Proc. Natl. Acad. Sci. U.S.A. 77, 7380 (1980); J. W. Gordon and F. H. Ruddle, Science 214, 1244 (1981); R. D. Palmiter and R. L. Brinster, Annu. Rev. Genet. 20, 465 (1986).
3. J. W. Gordon, G. A. Scangos, D. J. Plotkin, J. A. Barbosa, F. H. Ruddle, Proc. Natl. Acad. Sci. U.S.A. 77, 7380 (1980); J. W. Gordon and F. H. Ruddle, Science 214, 1244 (1981); R. D. Palmiter and R. L. Brinster, Annu. Rev. Genet. 20, 465 (1986).
4. J. W. Gordon, Int. Rev. Cytol. 115, 171 (1989).
5. M. J. Evans and M. H. Kaufman, Nature 292, 154 (1981); M. Kuehn, A. Bradley, E. J. Robertson, M. J. Evans, ibid. 326, 295 (1987).
6. M. J. Evans and M. H. Kaufman, Nature 292, 154 (1981); M. Kuehn, A. Bradley, E. J. Robertson, M. J. Evans, ibid. 326, 295 (1987).
7. D. Jähner, K. Haase, R. Mulligan, R. Jaenisch, Proc. Nati. Acad. Sci. U.S.A. 82, 6927 (1985); A. W. S. Chan, E. J. Homan, L. U. Ballou, J. C. Burns, R. D. Bremel, ibid. 95, 14028 (1998).
8. D. Jähner, K. Haase, R. Mulligan, R. Jaenisch, Proc. Nati. Acad. Sci. U.S.A. 82, 6927 (1985); A. W. S. Chan, E. J. Homan, L. U. Ballou, J. C. Burns, R. D. Bremel, ibid. 95, 14028 (1998).
9. Y. Kanegae et al., Nucleic Acids Res. 23, 3816 (1995).
10. M. Lavitrano et al., Cell 57, 717 (1989).
11. R. N. Brinster, E. P. Sandgren, R. R. Behringer, R. D. Palmiter, ibid. 59, 239 (1989); B. Maione, M. Lavitrano, C. Spadafora, A. A. Kiessling, Mol. Reprod. Dev. 50, 406 (1998).
12. R. N. Brinster, E. P. Sandgren, R. R. Behringer, R. D. Palmiter, ibid. 59, 239 (1989); B. Maione, M. Lavitrano, C. Spadafora, A. A. Kiessling, Mol. Reprod. Dev. 50, 406 (1998).
13. E. Huguet and P. Esponda, Mol. Reprod. Dev. 51, 42 (1998).
14. Y. Toyoda, unpublished observations.
15. Y. Kimura et al., Biol. Reprod. 58, 1407 (1998).
16. T. Wakayama and R. Yanagimachi, Nature Biotechnol. 16, 639 (1998).
17. 2 in air at 37°C has been detailed elsewhere (30). For microinjection, sperm heads were aspirated into a pipette attached to a piezoelectric pipette-driving unit and one injected per oocyte as described (30). Oocytes that lysed soon after injection were discarded. Where appropriate, dislocation of heads from tails was by the application of a single piezo pulse as described (31). This procedure disrupts membranes and thus represents a difference between the fresh spermatozoa used here and previous reports of live spermatozoa promoting transgenesis by IVF (7). We estimate that about 1 pl was displaced from the pipette interior per injection; 3 to 3.5 days after microinjection, we examined embryos for expression of GFP by epifluorescence microscopy with a UV light source (480 nm) with fluorescein isothiocyanate filters. This enabled the clear identification of nonfluorescent (non-GFP-expressing), weakly fluorescent, and strongly fluorescent embryos and mosaics, which were scored accordingly. Mouse methods strictly adhered to National Institutes of Health (Department of Health and Human Services) guidelines implemented by the University of Hawaii Animal Care and Use Committee.
18. The large (3.5 kb) Sal GI-Bam HI fragment of plasmid pCX-EGFP used here harbors a GFP gene expressed from a strong cytomegalovirus-IE-chicken β-actin enhancer-promoter combination [H. Niwa, K. Yamamura, J. Miyazaki, Gene 108, 193 (1991)] but lacks a eukaryotic origin of replication [G. Zhang, G. Vanessa, S. R. Kain, Biochem. Biophys. Res. Commun. 227, 707 (1996); T. Takada et al., Nature Biotechnol. 15, 458 (1997)].
19. The large (3.5 kb) Sal GI-Bam HI fragment of plasmid pCX-EGFP used here harbors a GFP gene expressed from a strong cytomegalovirus-IE-chicken β-actin enhancer-promoter combination [H. Niwa, K. Yamamura, J. Miyazaki, Gene 108, 193 (1991)] but lacks a eukaryotic origin of replication [G. Zhang, G. Vanessa, S. R. Kain, Biochem. Biophys. Res. Commun. 227, 707 (1996); T. Takada et al., Nature Biotechnol. 15, 458 (1997)].
20. The large (3.5 kb) Sal GI-Bam HI fragment of plasmid pCX-EGFP used here harbors a GFP gene expressed from a strong cytomegalovirus-IE-chicken β-actin enhancer-promoter combination [H. Niwa, K. Yamamura, J. Miyazaki, Gene 108, 193 (1991)] but lacks a eukaryotic origin of replication [G. Zhang, G. Vanessa, S. R. Kain, Biochem. Biophys. Res. Commun. 227, 707 (1996); T. Takada et al., Nature Biotechnol. 15, 458 (1997)].
21. 5 spermatozoa in CZB or NIM) by pipetting, to give a final DNA fragment concentration of 7 ng/μl. We incubated the DNA-sperm mixture at room temperature (about 25°C) or on ice for 1 min and then mixed it with a polyvinylpyrrolidone (PVP; average M, 360,000) solution to give a final concentration of about 10% (w/v) PVP; it was then placed on the microscope stage for microinjection. All injections were done in CZB-H at room temperature within 1 hour of sperm-DNA mixing or within 1 hour of sperm-Triton X-100 mixing.
22. 2, and 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) (1 mg/ml). We examined and scored embryos by light microscopy.
23. We used single-shot double transgenesis to generate embryos coexpressing two tg's after a single microinjection as described in (14). Sperm heads were coinjected with a DNA solution containing pCX-EGFP Sal GI-Bam HI fragment (2.5 ng/μl) and pCX-LacZ Sal GI-Pst I fragment (2.5 ng/μl). pCX-LacZ is a derivative of pCX-EGFP in which the EGFP gene is replaced by one that encodes β-galactosidase [M. Okabe, unpublished data]. After culture in vitro, we first scored embryos for GFP expression and then for β-galactosidase expression as described in (12, 15). For photography, we mounted embryos between a microscope slide and a coverslip and collected images to show development and GFP expression before fixation and staining to show LacZ expression.
24. M. Lavitrano, D. French, M. Zani, L. Frati, C. Spadafora, Mol. Reprod. Dev. 31, 161 (1992).
25. We divided the sperm suspension in each washing experiment into two 5-μl aliquots immediately after mixing and incubating with pCX-EGFP DNA for 1 min. One aliquot (washed sperm) was diluted and washed by mixing well with 50 μl of ice-cold, fresh CZB or NIM. We then pelleted both aliquot for 2 min at 20,000g, 2°C. The supernatant from the washed sperm aliquot was carefully removed and replaced with 5 μl of fresh CZB or NIM; we used the supernatant from the second aliquot to resuspend its own pellet (therefore, this sample was not washed).
26. 2 and the cytokinesis-blocking agent cytochalasin B at 5 μg/ml and incubated them for 6 hours at 37°C [A. BosMikich, D. G. Whittingham, K. T. Jones, Dev. Biol. 182, 172 (1997)]. We then transferred them to CZB and incubation continued under standard embryo culture conditions. We scored embryos for GFP expression after 3.5 days as described (12).
27. F. J. Longo, C. Krohne, W. W. Franke, J. Cell Biol. 105, 1105 (1987).
28. T. Wakayama and A. C. F. Perry, unpublished data; B. Maione, C. Pittoggi, L. Achene, R. Lorenzini, C. Spadafora, DNA Cell Biol. 16, 1087 (1997).
29. T. Wakayama and A. C. F. Perry, unpublished data; B. Maione, C. Pittoggi, L. Achene, R. Lorenzini, C. Spadafora, DNA Cell Biol. 16, 1087 (1997).
30. S. Ladha, P. S. James, D. Clark, E. A. Howes, R. Jones, J. Cell Sci. 110, 1041 (1997).
31. R. Y. Tsien, Annu. Rev. Biochem. 67, 509 (1998).
32. Ectopic GFP expression in skin was clearly discernible as a green color when pups were examined 1 to 4 days after delivery by incidental illumination from a UV light source (480 nm).
33. M. Okabe, unpublished data.
34. Tail-tip biopsies from 3- to 6-week-old, randomly selected green pups and their nongreen littermates were used for extraction of total, genomic DNA. Photography of tails was under a fluorescent stereomicroscope equipped with a 480/440-nm filter. In Southern blot analysis, 10 μg of genomic DNA per sample was digested with Eco RI and probed with the 733-base-pair Eco RI fragment of pCX-EGFP. We used forward (TTGAATTCGCCACCATGGTGAGC) and reverse (TTGAATTCTTACTTGTACAGCTCGTCC) oligonucleotide primers detection of the GFP gene by PCR of 1 μg of genomic DNA per reaction. Reaction parameters were 95°C for 9 min (1 cycle) and 94°C for 45 s, 60°C for 30 s, 72°C for 45 s (40 cycles).
35. Electrophoretically separated products were visualized after staining with ethidium bromide.
36. K. L. Kroll and E. Amaya, Development 122, 3173 (1996).
37. R. Yanagimachi in The Physiology of Reproduction, E. Knobil and J. D. Neill, Eds. (Raven Press, New York, ed. 2, 1994), pp. 189-317.
38. K. Goto, A. Kinoshita, Y. Takuma, K. Ogawa, Vet. Rec. 127, 517 (1990); N.-H. Kim, J. W. Lee, S. H. Jun, H. T. Lee, K. S. Chung, Mol. Reprod. Dev. 51, 436 (1998).
39. K. Goto, A. Kinoshita, Y. Takuma, K. Ogawa, Vet. Rec. 127, 517 (1990); N.-H. Kim, J. W. Lee, S. H. Jun, H. T. Lee, K. S. Chung, Mol. Reprod. Dev. 51, 436 (1998).
40. Y. Kimura and R. Yanagimachi, Biol. Reprod. 52, 709 (1995).
41. S. Kuretake, Y. Kimura, K. Hoshi, R. Yanagimachi, ibid. 55, 789 (1996).
42. Supported by grants to R.Y. from ProBio and the National Institute of Child Health and Human Development (HD-34362). A.C.F.P. was supported by a European Molecular Biology Organization Long Term Travel Fellowship. We thank P. Mombaerts and M. Paulus for helpful comments and M. Okada and H. Yanagimachi for technical assistance; we are grateful to J. Miyazaki for the CAG promoter and to I. Saito for pCANLacZ.