메뉴 건너뛰기




Volumn 281, Issue 5380, 1998, Pages 1191-1193

Prevention of allogeneic fetal rejection by tryptophan catabolism

Author keywords

[No Author keywords available]

Indexed keywords

1 METHYLTRYPTOPHAN; CD8 ANTIGEN; INDOLEAMINE 2,3 DIOXYGENASE; OXYGENASE INHIBITOR; PLACEBO; TRYPTOPHAN; TRYPTOPHAN DERIVATIVE; UNCLASSIFIED DRUG;

EID: 0032555614     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.281.5380.1191     Document Type: Article
Times cited : (2250)

References (21)
  • 4
    • 0027316304 scopus 로고
    • D. H. Munn and E. Armstrong, Cancer Res. 53, 2603 (1993); D. H. Munn, J. Pressey, A. C. Beall, R. Hudes, M. R. Alderson, J. Immunol. 156, 523 (1996).
    • (1993) Cancer Res. , vol.53 , pp. 2603
    • Munn, D.H.1    Armstrong, E.2
  • 6
    • 3543015051 scopus 로고    scopus 로고
    • 1-S transition and can be rescued by supplementing cultures with tryptophan or by adding 1-methyl-tryptophan
    • 1-S transition and can be rescued by supplementing cultures with tryptophan or by adding 1-methyl-tryptophan.
  • 10
    • 3543008437 scopus 로고    scopus 로고
    • note
    • Female CBA mice were mated with syngeneic or allogeneic (B6) male mice. Females with vaginal plugs (0.5 dpc) were examined at times indicated. Total RNA was prepared from dissected conceptus by homogenization in RNA-STAT 60 solution (Tel-TestB Inc.). Transcripts of the murine IDO gene [see (19)] were detected by the reverse transcription polymerase chain reaction (RT-PCR) using forward (GTACATCACCATGGCGTATG) and reverse (GCTT-TCGTCAAGTCTTCATTG) oligonucleotide primers. PCR products were of the expected size (740 bp). RT-PCR conditions used were 48°C for 45 min, 94°C for 2 min (1 cycle); 94°C for 30 s, 58°C for 1 min, 68°C for 2 min (40 cycles); and 68°C for 5 min (1 cycle). PCR products were fractionated on a 1.5% agarose-TBE gel containing ethidium bromide and were visualized by ultraviolet fluorescence. RT-PCR amplification of the murine α-actin gene (480 bp) was performed in parallel.
  • 11
    • 3542992145 scopus 로고    scopus 로고
    • note
    • Slow-release polymer pellets impregnated with 1-methyl-tryptophan (0.9 mg/hour) or placebo pellets were inserted surgically under dorsal skin at 4.5 dpc. Pregnant mice were examined at gestation times indicated. Results are summarized in Tables 1 and 2. Fecundity rates for mouse colonies bred at our institution are 6.4 (CBA X CBA and CBA X GK) and 5.4 (CBA X B6) pups per litter at parturition. All procedures involving mice were conducted in strict accordance with institutional guidelines for animal care.
  • 12
    • 3543018597 scopus 로고    scopus 로고
    • note
    • Tissues were prepared for sectioning by fixing them in 4% paraformaldehyde. Serial sections (5 (μm) were prepared using a microtome and were stained with hematoxylin and eosin before microscopic examination.
  • 13
    • 3543041360 scopus 로고    scopus 로고
    • note
    • During rejection, we observed mixed mononuclear cell infiltrates, disruption of trophoblast, and deterioration of the developing embryo. After rejection, all that remained were remnants of decidua surrounded by inflammatory infiltrates, necrotic tissue, and cellular debris.
  • 16
    • 3543028150 scopus 로고    scopus 로고
    • IDO transcription was induced in recipient spleen after adoptive transfer (M. Zhou, unpublished results)
    • IDO transcription was induced in recipient spleen after adoptive transfer (M. Zhou, unpublished results).
  • 19
    • 3543020394 scopus 로고    scopus 로고
    • Conditioned medium from cocultures of immunosuppressive macrophages and mitogen-stimulated T cells was used to support a second round of culture with mitogen-stimulated T cells. T cell proliferation was fully restored by adding tryptophan (D. Munn, unpublished results)
    • Conditioned medium from cocultures of immunosuppressive macrophages and mitogen-stimulated T cells was used to support a second round of culture with mitogen-stimulated T cells. T cell proliferation was fully restored by adding tryptophan (D. Munn, unpublished results).
  • 21
    • 3543007245 scopus 로고    scopus 로고
    • note
    • We thank A. Wylds, D. McCool, and R. Rogers for technical assistance; E Simpson, S. Rastan, and S. Goldman for critiquing; and A. Compton for preparing the manuscript. Supported by the MCG Research Institute (A.L.M. and S.J.C.), NIH awards (D.H.M. and S.J.C.), the March of Dimes (S.J.C.), the MCG Department of Medicine, and the Carlos and Marguerite Mason Trust.


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.