-
2
-
-
0028845691
-
-
A. Tafuri, J. Alferink, P. Möller, C. J. Hämmerling, B. Arnold, Science 270, 630 (1995).
-
(1995)
Science
, vol.270
, pp. 630
-
-
Tafuri, A.1
Alferink, J.2
Möller, P.3
Hämmerling, C.J.4
Arnold, B.5
-
4
-
-
0027316304
-
-
D. H. Munn and E. Armstrong, Cancer Res. 53, 2603 (1993); D. H. Munn, J. Pressey, A. C. Beall, R. Hudes, M. R. Alderson, J. Immunol. 156, 523 (1996).
-
(1993)
Cancer Res.
, vol.53
, pp. 2603
-
-
Munn, D.H.1
Armstrong, E.2
-
5
-
-
0030060388
-
-
D. H. Munn and E. Armstrong, Cancer Res. 53, 2603 (1993); D. H. Munn, J. Pressey, A. C. Beall, R. Hudes, M. R. Alderson, J. Immunol. 156, 523 (1996).
-
(1996)
J. Immunol.
, vol.156
, pp. 523
-
-
Munn, D.H.1
Pressey, J.2
Beall, A.C.3
Hudes, R.4
Alderson, M.R.5
-
6
-
-
3543015051
-
-
1-S transition and can be rescued by supplementing cultures with tryptophan or by adding 1-methyl-tryptophan
-
1-S transition and can be rescued by supplementing cultures with tryptophan or by adding 1-methyl-tryptophan.
-
-
-
-
7
-
-
0026177095
-
-
S. Kamimura, K. Eguchi, M. Yonezawa, K. Sekiba, Acta Med. Okayama 45, 135 (1991).
-
(1991)
Acta Med. Okayama
, vol.45
, pp. 135
-
-
Kamimura, S.1
Eguchi, K.2
Yonezawa, M.3
Sekiba, K.4
-
8
-
-
0029992282
-
-
H. Schrocksnadel, G. Baier-Bitterlich, O. Dapunt, H. Wachter, D. Fuchs, Obstet. Gynecol. 88, 47 (1996).
-
(1996)
Obstet. Gynecol.
, vol.88
, pp. 47
-
-
Schrocksnadel, H.1
Baier-Bitterlich, G.2
Dapunt, O.3
Wachter, H.4
Fuchs, D.5
-
10
-
-
3543008437
-
-
note
-
Female CBA mice were mated with syngeneic or allogeneic (B6) male mice. Females with vaginal plugs (0.5 dpc) were examined at times indicated. Total RNA was prepared from dissected conceptus by homogenization in RNA-STAT 60 solution (Tel-TestB Inc.). Transcripts of the murine IDO gene [see (19)] were detected by the reverse transcription polymerase chain reaction (RT-PCR) using forward (GTACATCACCATGGCGTATG) and reverse (GCTT-TCGTCAAGTCTTCATTG) oligonucleotide primers. PCR products were of the expected size (740 bp). RT-PCR conditions used were 48°C for 45 min, 94°C for 2 min (1 cycle); 94°C for 30 s, 58°C for 1 min, 68°C for 2 min (40 cycles); and 68°C for 5 min (1 cycle). PCR products were fractionated on a 1.5% agarose-TBE gel containing ethidium bromide and were visualized by ultraviolet fluorescence. RT-PCR amplification of the murine α-actin gene (480 bp) was performed in parallel.
-
-
-
-
11
-
-
3542992145
-
-
note
-
Slow-release polymer pellets impregnated with 1-methyl-tryptophan (0.9 mg/hour) or placebo pellets were inserted surgically under dorsal skin at 4.5 dpc. Pregnant mice were examined at gestation times indicated. Results are summarized in Tables 1 and 2. Fecundity rates for mouse colonies bred at our institution are 6.4 (CBA X CBA and CBA X GK) and 5.4 (CBA X B6) pups per litter at parturition. All procedures involving mice were conducted in strict accordance with institutional guidelines for animal care.
-
-
-
-
12
-
-
3543018597
-
-
note
-
Tissues were prepared for sectioning by fixing them in 4% paraformaldehyde. Serial sections (5 (μm) were prepared using a microtome and were stained with hematoxylin and eosin before microscopic examination.
-
-
-
-
13
-
-
3543041360
-
-
note
-
During rejection, we observed mixed mononuclear cell infiltrates, disruption of trophoblast, and deterioration of the developing embryo. After rejection, all that remained were remnants of decidua surrounded by inflammatory infiltrates, necrotic tissue, and cellular debris.
-
-
-
-
16
-
-
3543028150
-
-
IDO transcription was induced in recipient spleen after adoptive transfer (M. Zhou, unpublished results)
-
IDO transcription was induced in recipient spleen after adoptive transfer (M. Zhou, unpublished results).
-
-
-
-
19
-
-
3543020394
-
-
Conditioned medium from cocultures of immunosuppressive macrophages and mitogen-stimulated T cells was used to support a second round of culture with mitogen-stimulated T cells. T cell proliferation was fully restored by adding tryptophan (D. Munn, unpublished results)
-
Conditioned medium from cocultures of immunosuppressive macrophages and mitogen-stimulated T cells was used to support a second round of culture with mitogen-stimulated T cells. T cell proliferation was fully restored by adding tryptophan (D. Munn, unpublished results).
-
-
-
-
21
-
-
3543007245
-
-
note
-
We thank A. Wylds, D. McCool, and R. Rogers for technical assistance; E Simpson, S. Rastan, and S. Goldman for critiquing; and A. Compton for preparing the manuscript. Supported by the MCG Research Institute (A.L.M. and S.J.C.), NIH awards (D.H.M. and S.J.C.), the March of Dimes (S.J.C.), the MCG Department of Medicine, and the Carlos and Marguerite Mason Trust.
-
-
-
|