Dual recognition of double-stranded DNA by 2'-aminoethoxy-modified oligonucleotides

Angewandte Chemie - International Edition

Volumn 37, Issue 9, 1998, Pages 1288-1291

  Cuenoud, Bernard ^a   Casset, Florence ^b   Hüsken, Dieter ^b   Natt, François ^b   Wolf, Romain M ^b   Altmann, Karl Heinz ^b   Martin, Pierre ^b   Moser, Heinz E ^a  

^a NOVARTIS HORSHAM RESEARCH CENTRE   (United Kingdom)

^b NOVARTIS PHARMA AG   (Switzerland)

Author keywords

Bioorganic chemistry; DNA recognition; Molecular recognition; Oligonucleotides; Triple helices

Indexed keywords

AMINO ACID; BASE PAIRING; BINDING AFFINITY; DNA; ELECTRICITY; OLIGONUCLEOTIDE;

EID: 0032543145     PISSN: 14337851     EISSN: None     Source Type: Journal    
DOI: 10.1002/(SICI)1521-3773(19980518)37:9<1288::AID-ANIE1288>3.0.CO;2-U     Document Type: Article

References (23)

1. C. O. Pabo, R. T. Sauer, Annu. Rev. Biochem. 1992, 61, 1053-1095; D. Rhodes, J. W. R. Schwabe, L. Chapman, L. Fairall, Phil. Trans. R. Soc. London B 1996, 351, 501-509.
2. C. O. Pabo, R. T. Sauer, Annu. Rev. Biochem. 1992, 61, 1053-1095; D. Rhodes, J. W. R. Schwabe, L. Chapman, L. Fairall, Phil. Trans. R. Soc. London B 1996, 351, 501-509.
3. P.E. Nielsen, Chem. Eur. J. 1997, 3, 505-508; H. E. Moser, P. B. Dervan, Science 1987, 238, 645-650; J. W. Trauger, E. E. Baird, P. B. Dervan, Nature 1986, 382, 559-561.
4. P.E. Nielsen, Chem. Eur. J. 1997, 3, 505-508; H. E. Moser, P. B. Dervan, Science 1987, 238, 645-650; J. W. Trauger, E. E. Baird, P. B. Dervan, Nature 1986, 382, 559-561.
5. P.E. Nielsen, Chem. Eur. J. 1997, 3, 505-508; H. E. Moser, P. B. Dervan, Science 1987, 238, 645-650; J. W. Trauger, E. E. Baird, P. B. Dervan, Nature 1986, 382, 559-561.
6. S. Neidel, Anti-Cancer Drug Des. 1997, 12, 433-442; C. Giovannangeli, C. Hélène, Antisense Nucleic Acid Drug Dev. 1997, 7, 413-421; L. J. Maher, Cancer Invest. 1996, 14, 66-82.
7. S. Neidel, Anti-Cancer Drug Des. 1997, 12, 433-442; C. Giovannangeli, C. Hélène, Antisense Nucleic Acid Drug Dev. 1997, 7, 413-421; L. J. Maher, Cancer Invest. 1996, 14, 66-82.
8. S. Neidel, Anti-Cancer Drug Des. 1997, 12, 433-442; C. Giovannangeli, C. Hélène, Antisense Nucleic Acid Drug Dev. 1997, 7, 413-421; L. J. Maher, Cancer Invest. 1996, 14, 66-82.
9. C. Escudé, J.-C. François, J.-S. Sun, G. Ott, M. Sprinzl, T. Garestier, C. Hélène, Nucleic Acids Res. 1993, 21, 5547-5553.
10. W. T. Markiewicz, J. Chem. Res. Synop. 1979, 24-25; M. Krecmerova, H. Hrebacebecky, A. Holly, Collect. Czech. Chem. Commun. 1990, 55, 2521-2536.
11. W. T. Markiewicz, J. Chem. Res. Synop. 1979, 24-25; M. Krecmerova, H. Hrebacebecky, A. Holly, Collect. Czech. Chem. Commun. 1990, 55, 2521-2536.
12. The difference in melting temperature between the fully matched triplex and a complex containing one G:C mismatch in the double stranded DNA ds(GCTAAGAAGAGAGAGAGATCG) indicates a decrease of 9.9°C for the 2′-aminoethoxy-modified oligonucleotide and a decrease of 2.4°C for the unmodified DNA oligonucleotide control.
13. C. J. Guinosso, G. D. Hoke, S. Frier, J. F. Martin, D. J. Ecker, C. K. Mirabelli, S. T. Crooke, P. D. Cook, Nucl. Nucleotides 1991, 10, 259-262.
14. P. Martin, Helv. Chim. Acta 1995, 78, 486-504.
15. A. Szabo, L. Stolz, R. Granzow, Curr. Opin. Struct. Biol. 1995, 5, 699-705.
16. M. Rougée, B. Faucon, J.-L. Mergny, F. Barcelo, C. Giovannangeli, T. Garestier, C. Hélène, Biochemistry 1992, 31, 9269-9278; L. E. Xodo, Eur. J. Biochem. 1995, 228, 918-926.
17. M. Rougée, B. Faucon, J.-L. Mergny, F. Barcelo, C. Giovannangeli, T. Garestier, C. Hélène, Biochemistry 1992, 31, 9269-9278; L. E. Xodo, Eur. J. Biochem. 1995, 228, 918-926.
18. Upon binding of oligonucleotide I to its duplex DNA target, we observed by circular dichroism the appearance of two strong minima at 220 and 265 nm, indicative of the formation of a triple-strand complex: V. N. Soyfwer, V. N. Potaman, Triple-Helical Nucleic Acids, 1st ed., Springer, New York, 1995, pp. 54-55.
19. R. H. Griffey, B. P. Monia, L. L. Cummins, S. Freier, M. J. Greig, C. J. Guinosso, E. Lesnik, S. M. Manalili, V. Mohan, S. Owens, B. R. Ross, H. Sasmor, E. Wancewicz, K. Weiler, P. D. Wheeler, P. D. Cook, J. Med. Chem. 1996, 39, 5100-5109.
20. U. Pieles, W. Zürcher, M. Schär, H. E. Moser, Nucleic Acids Res. 1993, 21, 3191-3196.
21. T. J. Povsic, P. B. Dervan, J. Am. Chem. Soc. 1989, 111, 3059-3061.
22. V. Fritsch, R. Wolf, J. Biomol. Struct. Dyn. 1994, 11, 1161-1174.
23. E. S. Priestley, P. B. Dervan, J. Am. Chem. Soc. 1995, 117, 4761-4765.