메뉴 건너뛰기




Volumn 279, Issue 5353, 1998, Pages 1037-1041

The structure of GABPα/β: An ETS domain-ankyrin repeat heterodimer bound to DNA

Author keywords

[No Author keywords available]

Indexed keywords

ANKYRIN; PROTEIN SUBUNIT; DNA; DNA BINDING PROTEIN; GA BINDING PROTEIN; ONCOPROTEIN; PROTO ONCOGENE PROTEIN SPI 1; PROTO-ONCOGENE PROTEIN SPI-1; RECOMBINANT PROTEIN; TRANSACTIVATOR PROTEIN; TRANSCRIPTION FACTOR; TRANSCRIPTION FACTOR ETS;

EID: 0032512459     PISSN: 00368075     EISSN: None     Source Type: Journal    
DOI: 10.1126/science.279.5353.1037     Document Type: Article
Times cited : (269)

References (38)
  • 5
    • 0004227105 scopus 로고    scopus 로고
    • G. van de Woude and G. Klein, Eds. (Academic Press, San Diego, CA, in press)
    • B. J. Graves and J. M. Petersen, in Advances in Cancer Research, G. van de Woude and G. Klein, Eds. (Academic Press, San Diego, CA, in press).
    • Advances in Cancer Research
    • Graves, B.J.1    Petersen, J.M.2
  • 8
    • 0028785254 scopus 로고
    • published erratum Cell 87, following 355 (1996)
    • M. H. Werner et al., Cell 83, 761 (1995) [published erratum Cell 87, following 355 (1996)].
    • (1995) Cell , vol.83 , pp. 761
    • Werner, M.H.1
  • 18
    • 6844237880 scopus 로고    scopus 로고
    • note
    • In DNA dissociation experiments with the minimal fragments used in this study, GABPα dissociated with a half-life of less than 4 s, whereas the half-life of GABPα/β was ∼400 S.
  • 20
    • 6844225726 scopus 로고    scopus 로고
    • note
    • Two GABPβ genes have been identified, GABPβ1 and GABPβ2 (19). In this study we used GABPβ1. Residues 311 to 430 of GABPα and 1 to 157 of GABPβ expressed as precipitates in E. coli. The proteins were codialyzed from 8 M urea, purified as a complex by anion- and cation-exchange chromatography, and concentrated to 8 mg/ml. Purified AATGACCGGAAGTACACCGGA and TTCCGGTGTACTTCCGGTCAT 21-base oligonucleotides were added to protein in slight molar excess and dialyzed into 20 mM tris (pH 8), 1 mM EDTA, 1 mM dithiothreitol, and 0.001% sodium azide. Equal volumes of protein-DNA solution and well solution [100 mM bis-tris propane (pH 9), 5 mM cobaltic hexamine chloride, 9% polyethylene glycol (PEG) 1000] were mixed, and hanging drops were allowed to equilibrate by vapor diffusion at 20°C. Crystals were transferred into cryosolutions containing well solution with 12% PEG 1000 and 24% glycerol. Optimal diffraction was obtained if crystals were cross-linked by exposure to glutaraldehyde vapor for 10 min. For the 2Hg derivative, a cross-linked crystal was soaked in 1 mM EMTS (ethylmercurithiosalicylate) for 24 hours.
  • 22
    • 0030666003 scopus 로고    scopus 로고
    • F. Y. Luh et al., Nature 389, 999 (1997).
    • (1997) Nature , vol.389 , pp. 999
    • Luh, F.Y.1
  • 25
    • 6844257000 scopus 로고    scopus 로고
    • note
    • Ets-1 fragments ΔN331 or ΔN280 (31) did not interact with GABPβ 1 or 2 in electrophoretic mobility-shift assays when mixed or codialyzed from 8 M urea.
  • 26
    • 6844262741 scopus 로고    scopus 로고
    • note
    • 418 results in a steric clash with neighboring hydrophobic residues.
  • 27
    • 0024058085 scopus 로고
    • Curvature of the DNA was calculated for the 9 bp contacting GABPα with the program CURVES; R. Lavery and H. Sklenar, J. Biomol. Struct. Dyn. 6, 63 (1988).
    • (1988) J. Biomol. Struct. Dyn. , vol.6 , pp. 63
    • Lavery, R.1    Sklenar, H.2
  • 31
  • 35
    • 0002452464 scopus 로고
    • L. Sawyer, N. Isaacs, S. Bailey, Eds. Science and Engineering Research Council Daresbury Laboratory, Warrington, UK
    • Z. Otwinowski, in Proceedings of the CCP4 Study Weekend: Data Collection and Processing, L. Sawyer, N. Isaacs, S. Bailey, Eds. (Science and Engineering Research Council Daresbury Laboratory, Warrington, UK, 1993), pp. 56-62.
    • (1993) Proceedings of the CCP4 Study Weekend: Data Collection and Processing , pp. 56-62
    • Otwinowski, Z.1
  • 36
    • 0028103275 scopus 로고
    • Collaborative Computational Project Number 4
    • Collaborative Computational Project Number 4, Acta Crystallogr. D50, 760 (1994).
    • (1994) Acta Crystallogr. , vol.D50 , pp. 760
  • 38
    • 6844233838 scopus 로고    scopus 로고
    • note
    • We thank S. Soisson and E. Reisinger for continuous assistance; S. Prigge, D. Hammontree, and D. Leahy for programs; M. Bianchet and M. Amzel for x-ray room assistance; C. Ogata for beamline assistance; N. Pavletich for 53BP2 coordinates; and B. Graves for Ets-1 samples. This work was initiated during a sabbatical visit by S.L.M. in the laboratory of C.W. At that time S.L.M. was supported by the Carnegie Institute of Washington and the Howard Hughes Medical Institute. A.H.B., D.E.P., and C.W. were supported by the Howard Hughes Medical Institute. C.W. also received support from the David and Lucile Packard Foundation. Coordinates have been deposited at the Brookhaven Protein Data Bank (accession code 1 awc).


* 이 정보는 Elsevier사의 SCOPUS DB에서 KISTI가 분석하여 추출한 것입니다.